Loading...

TotalSeq™-D0384 anti-human IgD Antibody

Pricing & Availability
Clone
IA6-2 (See other available formats)
Regulatory Status
RUO
Other Names
Ig delta chain C region
Isotype
Mouse IgG2a, κ
Barcode Sequence
CAGTCTCCGTAGAGT
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Save
348251 10 µg ¥78,760
Description

IgD, a member of the immunoglobulin (Ig) family, is expressed in naïve B cells. It has 3 Ig-like domains and exists in a transmembrane and a soluble form. In general, IgD is not secreted and usually its expression is lost after the Ig isotype switch. After antigen binding, IgD signals through the CD79a/CD79b (Igα/Igβ) heterodimer, resulting in the activation of the B cell.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human IgD
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of paraformaldehyde fixed frozen sections4 and spatial biology (IBEX)5,6.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Chen K, et al. 2009. Nat. Immunol. 10:889.
  2. Lee CH, et al. 2005. J. Exp. Med. 203:63.
  3. Sutter JA, et al. 2008. Clin. Immunol. 126:282.
  4. Li H and Pauza CD. 2015. Eur. J. Immunol. 45:298. (IHC)
  5. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  6. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2924547 (BioLegend Cat. No. 348251)

Antigen Details

Structure
Exists in a transmembranal and a soluble form
Distribution

Naïve B cells

Function
Antigen binding, B cell activation
Interaction
The CD79a/CD79b heterodimer
Cell Type
B cells
Biology Area
Immunology
Antigen References

1. Geisberger R, et al. 2006. Immunology 118:429.
2. Weller S, et al. 2005. Eur. J. Immunol. 35:2789.
3. Brandtzaeg P and Johansen FE. 2005. Immunol. Rev. 206:32.

Gene ID
3495 View all products for this Gene ID
UniProt
View information about IgD on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 09/02/2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account