- Clone
- 9D9F9 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Receptor tyrosine Kinase VEGFR-3, VEGFR3, FLT4
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TGATCCGAAGTCGTG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Receptor tyrosine Kinase VEGFR-3, also known as FLT4, together with VEGFR1 (FIT1) and VEGFR2 (KDR/Flk-1), are the receptors for vascular endothelial growth factors (VEGF). The VEGFR family belongs to the class II subfamily of receptor tyrosine kinases (RTKs), containing a large extracellular region which is composed of seven Ig-like domains (D1–D7), a single transmembrane, helix, and a cytoplasmic region with tyrosine kinase activity. In VEGFR-3, the fifth Ig homology domain is proteolytically cleaved which results in polypeptides that remain linked by two disulfide bonds. VEGFR-3 is widely expressed on all endothelial cells in early embryogenesis, while, in adult tissues, VEGFR-3 expression disappears from the vascular endothelial cells and is observed only on the lymphatic endothelium. VEGF-C and VEGF-D activation of VEGFR-3 plays an important role in the formation of the lymphatic vessel system. Aberrant activation or expression of VEGFR and their ligands has been implicated in tumor angiogenesis, coronary artery disease, diabetic blindness, and other diseases.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- VEGFR extracellular domain protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for relevant formats) include: immunohistochemistry staining of frozen or paraffin embedded sections1-3.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Jussila L, et al. 1998. Cancer Res. 58:1599. (IHC)
- Kilic N, et al. 2007. Blood 110:4223. (IHC)
- Folpe A, et al. 2000. Mod. Pathol. 13:180. (IHC)
Antigen Details
- Structure
- Seven Ig-like domains in the extracellular domain, a single transmembrane helix, and a cytoplasmic region with tyrosine kinase activity
- Distribution
-
Widely expressed in early embryogenesis endothelial cells, restrictly expressed on lymphatic endothelial cells in adults
- Function
- Mediates lymphangiogenesis in response to VEGF-C and VEGF-D, involved in cardiovascular development during embryogenesis
- Ligand/Receptor
- VEGF-C, VEGF-D
- Biology Area
- Cell Biology, Immunology, Signal Transduction
- Molecular Family
- Cytokine/Chemokine Receptors
- Antigen References
-
1. Tammela T, et al. 2008. Nature 454:656.
2. Partanen TA, et al. 2000. FASEB J. 14:2087.
3. Valtola R, et al. 1999. Am. J. Pathol. 154:1381.
4. Jussila L, et al. 1998. Cancer Res. 58:1599.
5. Galland F, et al. 1992. Genomics 13:475. - Gene ID
- 2324 View all products for this Gene ID
- UniProt
- View information about VEGFR-3 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All VEGFR-3 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human VEGFR-3 (FLT-4) | 9D9F9 | FC,IHC-P,IHC-F |
PE anti-human VEGFR-3 (FLT-4) | 9D9F9 | FC |
APC anti-human VEGFR-3 (FLT-4) | 9D9F9 | FC |
TotalSeq™-A0865 anti-human VEGFR-3 (FLT-4) | 9D9F9 | PG |
TotalSeq™-C0865 anti-human VEGFR-3 (FLT-4) Antibody | 9D9F9 | PG |
TotalSeq™-D0865 anti-human VEGFR-3 (FLT-4) Antibody | 9D9F9 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us