Loading...

TotalSeq™-D0897 anti-human CD23 Antibody

Pricing & Availability
Clone
EBVCS-5 (See other available formats)
Regulatory Status
RUO
Other Names
Leu-20, FcεRII, IgE Fc Receptor, BLAST-2, B6, Low affinity IgE receptor
Isotype
Mouse IgG1, κ
Barcode Sequence
TCTGTATAACCGTCT
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Save
338529 10 µg ¥81,180
Description

CD23 is a 45 kD protein, also known as Leu-20, FcεRII, IgE Fc receptor, BLAST-2, B6, and low affinity IgE receptor. It is a member of the Ig family, expressed on most mature B cells, B cells in follicular mantle (but not in proliferating germinal center cells, follicular dendritic cells, monocytes, eosinophils, Langerhans cells, and a subset of T cells (10-15% of tonsillar T cells). CD23 responds to high levels of IgE by downregulating IgE secretion. In human monocytes, CD23 triggering results in release of pro-inflammatory cytokines including TNF-α, IL-1, IL-6, and GM-CSF. CD23 can be proteolytically cleaved to generate soluble CD23 fragments of various molecular weights. In chronic lymphocytic leukemia, levels of soluble CD23 in the serum can be used as a prognostic marker to identify patients at high risk for disease progression. Alternate splicing of exon 2 can also generate two cell-surface isoforms of CD23 differing by 6 amino acids in their cytoplasmic region.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Sugden B and Metzenberg S. 1983. J. Virol. 46:800-807.
RRID
AB_2922556 (BioLegend Cat. No. 338529)

Antigen Details

Structure
Ig family member, type II transmembrane glycoprotein, 45 kD
Distribution

B cells, follicular dendritic cells, monocytes, eosinophils, a subset of T cells, Langerhans cells

Function
Regulation of IgE synthesis in human monocytes; CD23 triggering results in release of pro-inflammatory cytokines including TNF-a, IL-1, IL-6, and GM-CSF
Ligand/Receptor
IgE, CD19/CD21/CD81
Cell Type
B cells, Dendritic cells, Eosinophils, Langerhans cells, Monocytes, T cells
Biology Area
Immunology
Molecular Family
CD Molecules, Fc Receptors
Antigen References

1. Ludin C, et al. 1987. EMBO J. 6:109.
2. Delespesse G, et al. 1992. Immunol. Rev. 125:77.
3. Flores-Romo L, et al. 1993. Science 261:1038.
4. Armant M, et al. 1994. J. Exp. Med. 180:1005.

Gene ID
2208 View all products for this Gene ID
UniProt
View information about CD23 on UniProt.org
Go To Top Version: 1    Revision Date: 03/21/2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account