- Clone
- BY55 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- BY55, NK1, NK28
- Isotype
- Mouse IgM, κ
- Barcode Sequence
- GGCTAGAAATCAACG
- Ave. Rating
- Submit a Review
CD160 is a 27 kD GPI-anchored glycoprotein also known as BY55, NK1, and NK28. A member the Ig superfamily, CD160 exists as a disulfide-bond multimer, expressed on the surface of a subpopulation of NK cells, γ/δ T cells, subset of CD8+ T cells, and intestinal intraepithelial lymphocytes (IEL). CD160 plays costimulatory roles through binding to classical and nonclassical MHC-I molecules.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Anumanthan A, et al. 1998. J. Immunol. 161:2780.
- Maiza H, et al. 1993. J. Exp. Med. 178:1121.
- RRID
-
AB_2894626 (BioLegend Cat. No. 341219)
Antigen Details
- Structure
- 27 kD GPI-anchored glycoprotein, Ig superfamily
- Distribution
-
Subpopulation of NK cells, γ/δ T cells, subset of CD8+ T cells, and intestinal intraepithelial lymphocytes (IEL)
- Function
- Costimulation
- Ligand/Receptor
- Classical and nonclassical MHC-I molecules
- Cell Type
- NK cells, T cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules: The CD Markers Wiley-Liss A John Wiley & Sons Inc, Publication.
2. Merino J, et al. 2007. Clin. Exp. Immunol. 149:87.
3. Barakonyi A, et al. 2004. J. Immunol. 173:5349. - Gene ID
- 11126 View all products for this Gene ID
- UniProt
- View information about CD160 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD160 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD160 | BY55 | FC,IP |
Alexa Fluor® 647 anti-human CD160 | BY55 | FC |
APC anti-human CD160 | BY55 | FC |
PE anti-human CD160 | BY55 | FC |
PerCP/Cyanine5.5 anti-human CD160 | BY55 | FC |
PE/Cyanine7 anti-human CD160 | BY55 | FC |
Biotin anti-human CD160 | BY55 | FC |
TotalSeq™-C1045 anti-human CD160 | BY55 | PG |
TotalSeq™-B1045 anti-human CD160 | BY55 | PG |
TotalSeq™-D1045 anti-human CD160 | BY55 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD160
-
Alexa Fluor® 647 anti-human CD160
Human peripheral blood lymphocytes stained with BY55 Alexa F... -
APC anti-human CD160
Human peripheral blood lymphocytes were stained with CD8 PE ... -
PE anti-human CD160
Human peripheral blood lymphocytes were stained with CD8 APC... -
PerCP/Cyanine5.5 anti-human CD160
Human peripheral blood lymphocytes were stained with CD8 APC... -
PE/Cyanine7 anti-human CD160
Human peripheral blood lymphocytes were stained with CD8 APC... -
Biotin anti-human CD160
Human peripheral blood lymphocytes were stained with CD8 APC... -
TotalSeq™-C1045 anti-human CD160
-
TotalSeq™-B1045 anti-human CD160
-
TotalSeq™-D1045 anti-human CD160
Follow Us