TotalSeq™-D0081 anti-human CD14 antibody, CD14, M5E2

Pricing & Availability

Clone: M5E2 (See other available formats)
Regulatory Status: RUO
Workshop: III 329
Other Names: LPS receptor
Isotype: Mouse IgG2a, κ
Barcode Sequence: TCTCAGACCTCCGTA
Ave. Rating: Submit a Review
Product Citations: publications

Compare all formats

Cat #

Size

Price

Quantity Check Availability

Save

301865

10 µg

296€

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

CD14 is a 53-55 kD glycosylphosphatidylinositol (GPI)-linked membrane glycoprotein also known as LPS receptor. CD14 is expressed at high levels on monocytes and macrophages, and at lower levels on granulocytes. Some dendritic cell populations such as interfollicular dendritic cells, reticular dendritic cells, and Langerhans cells have also been reported to express CD14. As a high-affinity receptor for LPS, CD14 is involved in the clearance of gram-negative pathogens, and in the upregulation of adhesion molecules and expression of cytokines in monocytes and neutrophils.

Product Details

Technical Data Sheet (pdf)

Product Details

Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: African Green, Capuchin Monkey, Cow, Chimpanzee, Common Marmoset, Cotton-topped Tamarin, Dog, Pigtailed Macaque, Squirrel Monkey
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Full-length human CD14 protein
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The M5E2 antibody inhibits monocyte activation and cytokine production induced by LPS. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections, blocking of LPS stimulation⁴, and immunofluorescence microscopy⁵. Clone M5E2 is not recommended for immunohistochemical staining of formalin-fixed paraffin-embedded sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 301861 and 301862).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2892347 (BioLegend Cat. No. 301865)

Antigen Details

Structure: GPI-linked membrane glycoprotein, 53-55 kD
Distribution: Monocytes, macrophages, granulocytes (low)
Function: LPS receptor, clearance of Gram-negative pathogens
Ligand/Receptor: LPS
Cell Type: Granulocytes, Macrophages, Monocytes, Neutrophils
Biology Area: Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family: CD Molecules
Antigen References: 1. Stocks S, et al. 1990. Biochem. J. 268:275.
2. Wright S, et al. 1990. Science 249:1434.
Gene ID: 929 View all products for this Gene ID
UniProt: View information about CD14 on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD14 Reagents Request Custom Conjugation

Description	Clone	Applications
APC anti-human CD14	M5E2	FC
FITC anti-human CD14	M5E2	FC
PE anti-human CD14	M5E2	FC
Purified anti-human CD14	M5E2	FC,CyTOF®,Block,IHC-F
PE/Cyanine7 anti-human CD14	M5E2	FC
Alexa Fluor® 488 anti-human CD14	M5E2	FC
Alexa Fluor® 647 anti-human CD14	M5E2	FC
Ultra-LEAF™ Purified anti-human CD14	M5E2	FC,CyTOF®,Block,IHC-F
Pacific Blue™ anti-human CD14	M5E2	FC
APC/Cyanine7 anti-human CD14	M5E2	FC
Alexa Fluor® 700 anti-human CD14	M5E2	FC
PerCP/Cyanine5.5 anti-human CD14	M5E2	FC
Biotin anti-human CD14	M5E2	FC
Brilliant Violet 421™ anti-human CD14	M5E2	FC
Brilliant Violet 570™ anti-human CD14	M5E2	FC
Brilliant Violet 605™ anti-human CD14	M5E2	FC
Brilliant Violet 650™ anti-human CD14	M5E2	FC
Brilliant Violet 711™ anti-human CD14	M5E2	FC
Brilliant Violet 785™ anti-human CD14	M5E2	FC
Brilliant Violet 510™ anti-human CD14	M5E2	FC
Purified anti-human CD14 (Maxpar® Ready)	M5E2	FC,CyTOF®
PerCP anti-human CD14	M5E2	FC
FITC anti-human CD14	M5E2	FC
PE/Dazzle™ 594 anti-human CD14	M5E2	FC
Pacific Blue™ anti-human CD14	M5E2	FC
APC/Fire™ 750 anti-human CD14	M5E2	FC
APC anti-human CD14	M5E2	FC
TotalSeq™-A0081 anti-human CD14	M5E2	PG
TotalSeq™-B0081 anti-human CD14	M5E2	PG
TotalSeq™-C0081 anti-human CD14	M5E2	PG
PE anti-human CD14	M5E2	FC
PE/Cyanine5 anti-human CD14	M5E2	FC
TotalSeq™-D0081 anti-human CD14	M5E2	PG
APC/Fire™ 750 anti-human CD14	M5E2	FC
GMP FITC anti-human CD14	M5E2	FC
PE/Cyanine7 anti-human CD14	M5E2	FC
GMP APC anti-human CD14	M5E2	FC
GMP PE anti-human CD14	M5E2	FC
PE/Dazzle™ 594 anti-human CD14	M5E2	FC
GMP Pacific Blue™ anti-human CD14	M5E2	FC
GMP APC/Fire™ 750 anti-human CD14	M5E2	FC
PerCP/Cyanine5.5 anti-human CD14	M5E2	FC
Spark Violet™ 500 anti-human CD14	M5E2	FC
GMP PE/Dazzle™ 594 anti-human CD14	M5E2	FC
APC/Fire™ 810 anti-human CD14	M5E2	FC
PE/Fire™ 700 anti-human CD14	M5E2	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.