- Clone
- MOPC-173 (See other available formats)
- Regulatory Status
- RUO
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- CTCCTACCTAAACTG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
400299 | 10 µg | 296€ |
The MOPC-173 immunoglobulin has unknown specificity. The isotype of this antibody is mouse IgG2a, κ. This antibody was chosen as an isotype control after screening on a variety of resting, activated, live, and fixed mouse, rat, and human tissues.
Product DetailsProduct Details
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: Intracellular Flow Cytometry (ICFC), Immunocytochemistry (ICC), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western Blotting (WB), Functional Assay (FA).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Product Citations
-
- RRID
-
AB_3097117 (BioLegend Cat. No. 400299)
Antigen Details
- Gene ID
- NA
Related Pages & Pathways
Pages
Related FAQs
- IgG2a gene is deleted in some mouse strains, which ones are they?
-
IgG2a gene is deleted in C57Bl/6, C57Bl/10, SJL, and NOD mice. It is replaced with IgG2c gene instead.
Other Formats
View All Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC Mouse IgG2a, κ Isotype Ctrl
-
Biotin Mouse IgG2a, κ Isotype Ctrl
-
FITC Mouse IgG2a, κ Isotype Ctrl
-
PE Mouse IgG2a, κ Isotype Ctrl
-
PE/Cyanine5 Mouse IgG2a, κ Isotype Ctrl
-
Purified Mouse IgG2a, κ Isotype Ctrl
-
APC/Cyanine7 Mouse IgG2a, κ Isotype Ctrl
-
PE/Cyanine7 Mouse IgG2a, κ Isotype Ctrl
-
Alexa Fluor® 647 Mouse IgG2a, κ Isotype Ctrl
-
Alexa Fluor® 488 Mouse IgG2a, κ Isotype Ctrl
-
Pacific Blue™ Mouse IgG2a, κ Isotype Ctrl
-
PE Mouse IgG2a, κ Isotype Ctrl (ICFC)
-
FITC Mouse IgG2a, κ Isotype Ctrl (FC)
-
PE Mouse IgG2a, κ Isotype Ctrl (FC)
-
APC Mouse IgG2a, κ Isotype Ctrl (FC)
-
Brilliant Violet 605™ Mouse IgG2a, κ Isotype Ctrl
-
Alexa Fluor® 700 Mouse IgG2a, κ Isotype Ctrl
-
PerCP Mouse IgG2a, κ Isotype Ctrl
-
PerCP/Cyanine5.5 Mouse IgG2a, κ Isotype Ctrl
-
Brilliant Violet 421™ Mouse IgG2a, κ Isotype Ctrl
-
Brilliant Violet 570™ Mouse IgG2a, κ Isotype Ctrl
-
Ultra-LEAF™ Purified Mouse IgG2a, κ Isotype Ctrl
-
Brilliant Violet 510™ Mouse IgG2a, κ Isotype Ctrl
-
Brilliant Violet 650™ Mouse IgG2a, κ Isotype Ctrl
-
Brilliant Violet 711™ Mouse IgG2a, κ Isotype Ctrl
-
Brilliant Violet 785™ Mouse IgG2a, κ Isotype Ctrl
-
PE/Dazzle™ 594 Mouse IgG2a, κ Isotype Ctrl
-
Alexa Fluor® 594 Mouse IgG2a, κ Isotype Ctrl
-
FITC Mouse IgG2a, κ Isotype Ctrl
-
APC/Fire™ 750 Mouse IgG2a, κ Isotype Ctrl
-
Pacific Blue™ Mouse IgG2a, κ Isotype Ctrl
-
APC Mouse IgG2a, κ Isotype Ctrl
-
PE/Dazzle™ 594 Mouse IgG2a, κ Isotype Ctrl
-
PE Mouse IgG2a, κ Isotype Ctrl
-
TotalSeq™-A0091 Mouse IgG2a, κ isotype Ctrl
-
TotalSeq™-B0091 Mouse IgG2a, κ isotype Ctrl
-
TotalSeq™-C0091 Mouse IgG2a, κ isotype Ctrl
-
PE/Cyanine7 Mouse IgG2a, κ Isotype Ctrl
-
APC/Fire™ 750 Mouse IgG2a, κ Isotype Ctrl
-
PerCP/Cyanine5.5 Mouse IgG2a, κ Isotype Ctrl
-
KIRAVIA Blue 520™ Mouse IgG2a, κ Isotype Ctrl
-
Spark Blue™ 550 Mouse IgG2a, κ Isotype Ctrl
-
Spark NIR™ 685 Mouse IgG2a, κ Isotype Ctrl
-
Spark Violet™ 538 Mouse IgG2a, κ Isotype Ctrl
-
Spark YG™ 581 Mouse IgG2a, κ Isotype Ctrl
-
TotalSeq™-D0091 Mouse IgG2a, κ Isotype Ctrl
-
Spark YG™ 593 Mouse IgG2a, κ Isotype Ctrl
-
GMP PE Mouse IgG2a, κ Isotype Ctrl
-
GMP FITC Mouse IgG2a, κ Isotype Ctrl
-
GMP APC Mouse IgG2a, κ Isotype Ctrl
-
GMP PE/Dazzle™ 594 Mouse IgG2a, κ Isotype Ctrl
-
GMP APC/Fire™ 750 Mouse IgG2a, κ Isotype Ctrl
-
GMP PerCP/Cyanine5.5 Mouse IgG2a, κ Isotype Ctrl
-
PE/Fire™ 700 Mouse IgG2a, κ Isotype Ctrl
-
PE/Fire™ 810 Mouse IgG2a, κ Isotype Ctrl
-
PE/Fire™ 640 Mouse IgG2a, κ Isotype Ctrl
-
GMP PE/Cyanine7 Mouse IgG2a, κ Isotype Ctrl
-
GMP Pacific Blue™ Mouse IgG2a, κ Isotype Ctrl
-
Spark YG™ 570 Mouse IgG2a, κ Isotype Ctrl
-
Spark Violet™ 423 Mouse IgG2a, κ Isotype Ctrl
-
APC/Fire™ 810 Mouse IgG2a, κ Isotype Ctrl
-
PerCP/Fire™ 806 Mouse IgG2a, κ Isotype Ctrl
-
PerCP/Fire™ 780 Mouse IgG2a, κ Isotype Ctrl
-
Spark Red™ 718 Mouse IgG2a, κ Isotype Ctrl
-
Spark Blue™ 515 Mouse IgG2a, κ Isotype Ctrl
-
Spark Blue™ 574 Mouse IgG2a, κ Isotype Ctrl
-
PE/Fire™ 744 Mouse IgG2a, κ Isotype Ctrl
-
Alexa Fluor® 660 Mouse IgG2a, κ Isotype Ctrl
-
Spark UV™ 387 Mouse IgG2a, κ Isotype Ctrl
Follow Us