- Clone
- RTK4530 (See other available formats)
- Regulatory Status
- RUO
- Isotype
- Rat IgG2b, κ
- Barcode Sequence
- GATTCTTGACGACCT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
400697 | 10 µg | 296€ |
The isotype of RTK4530 immunoglobulin is rat IgG2b, κ. This antibody was chosen as an isotype control after screening on a variety of resting, activated, live, and fixed mouse, rat and human tissues.
Product DetailsProduct Details
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Trinitrophenol + KLH
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The RTK4530 immunoglobulin is useful as an isotype-matched control (for the relevant formats) for Western blotting, immunoprecipitation, immunohistochemistry, functional assay, and immunofluorescence microscopy. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 400643, 400644, 400671, 400672, 400675, and 400676) as negative control.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Cervantes-Barragan L, et al. 2007. Blood 109:1131.
- Zeiser R, et al. 2007. Blood 109:2225.
- Sasaki K, et al. 2008. J. Immunol. 181:104. PubMed
- Duan J, et al. 2008. P. Natl. Acad. Sci. USA 105:5183. PubMed
- Yi H, et al. 2009. Blood 113:5819. PubMed
- Schafeer JS, et al. 2010. J. Leukocyte Biol. 87:301. PubMed
- Lei GS, et al. 2015. Infect Immun. 83:572. PubMed
- Richards J, et al. 2015. Mol Cell Cardiol. 79:21. PubMed
- RRID
-
AB_3097167 (BioLegend Cat. No. 400697)
Antigen Details
- Gene ID
- NA
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC Rat IgG2b, κ Isotype Ctrl
-
Biotin Rat IgG2b, κ Isotype Ctrl
-
FITC Rat IgG2b, κ Isotype Ctrl
-
PE Rat IgG2b, κ Isotype Ctrl
-
PE/Cyanine5 Rat IgG2b, κ Isotype Ctrl
-
Purified Rat IgG2b, κ Isotype Ctrl
-
PE/Cyanine7 Rat IgG2b, κ Isotype Ctrl
-
APC/Cyanine7 Rat IgG2b, κ Isotype Ctrl
-
Alexa Fluor® 647 Rat IgG2b, κ Isotype Ctrl
-
Alexa Fluor® 488 Rat IgG2b, κ Isotype Ctrl
-
Pacific Blue™ Rat IgG2b, κ Isotype Ctrl
-
Alexa Fluor® 700 Rat IgG2b, κ Isotype Ctrl
CD57BL/6 mouse splenocytes stained with RTK4530 Alexa Fluor®... -
PerCP Rat IgG2b, κ Isotype Ctrl
-
PerCP/Cyanine5.5 Rat IgG2b, κ Isotype Ctrl
-
Brilliant Violet 421™ Rat IgG2b, κ Isotype Ctrl
-
Brilliant Violet 570™ Rat IgG2b, κ Isotype Ctrl
-
Ultra-LEAF™ Purified Rat IgG2b, κ Isotype Ctrl
-
Brilliant Violet 510™ Rat IgG2b, κ Isotype Ctrl
-
Brilliant Violet 605™ Rat IgG2b, κ Isotype Ctrl
-
Brilliant Violet 785™ Rat IgG2b, κ Isotype Ctrl
-
Brilliant Violet 650™ Rat IgG2b, κ Isotype Ctrl
-
Brilliant Violet 711™ Rat IgG2b, κ Isotype Ctrl
-
PE/Dazzle™ 594 Rat IgG2b, κ Isotype Ctrl
-
Alexa Fluor® 594 Rat IgG2b, κ Isotype Ctrl
-
GoInVivo™ Purified Rat IgG2b, κ Isotype Ctrl
-
APC/Fire™ 750 Rat IgG2b, κ Isotype Ctrl
-
TotalSeq™-A0095 Rat IgG2b, κ Isotype Ctrl
-
TotalSeq™-C0095 Rat IgG2b, κ Isotype Ctrl
-
KIRAVIA Blue 520™ Rat IgG2b, κ Isotype Ctrl
-
Spark Blue™ 550 Rat IgG2b, κ Isotype Ctrl
-
PE/Fire™ 640 Rat IgG2b, κ Isotype Ctrl
-
APC/Fire™ 810 Rat IgG2b, κ Isotype Ctrl
-
PE/Fire™ 700 Rat IgG2b, κ Isotype Ctrl
-
TotalSeq™-B0095 Rat IgG2b, κ Isotype Ctrl
-
TotalSeq™-D0095 Rat IgG2b, κ Isotype Ctrl
-
PE/Fire™ 810 Rat IgG2b, κ Isotype Ctrl
-
Brilliant Violet 750™ Rat IgG2b, κ Isotype Ctrl
-
Spark YG™ 570 Rat IgG2b, κ Isotype Ctrl
-
Spark NIR™ 685 Rat IgG2b, κ Isotype Ctrl
-
Spark Blue™ 574 Rat IgG2b, κ Isotype Ctrl
-
PerCP/Fire™ 806 Rat IgG2b, κ Isotype Ctrl
-
Spark Blue™ 515 Rat IgG2b, κ Isotype Ctrl
-
PerCP/Fire™ 780 Rat IgG2b, κ Isotype Ctrl
-
Spark Red™ 718 Rat IgG2b, κ Isotype Ctrl
-
TotalSeq™-Bn0095 Rat IgG2b, κ Isotype Ctrl
-
Spark Violet™ 538 Rat IgG2b, κ Isotype Ctrl
-
Spark UV™ 387 Rat IgG2b, κ Isotype Ctrl
-
Spark PLUS UV395™ Rat IgG2b, κ Isotype Ctrl
-
PE/Fire™ 744 Rat IgG2b, κ Isotype Ctrl
Follow Us