TotalSeq™-D0152 anti-human CD223 (LAG-3) Antibody

Pricing & Availability
Clone
11C3C65 (See other available formats)
Regulatory Status
RUO
Other Names
CD223, LAG-3, LAG3, lymphocyte-activation gene-3
Isotype
Mouse IgG1, κ
Barcode Sequence
CATTTGTCTGCCGGT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
369339 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD223, also known as LAG-3, is a 70 kD type I transmembrane glycoprotein that is involved in T-cell signaling. Similar to CD4, CD223 binds MHC class II, but with a higher affinity. CD223 negatively regulates T-cell activation. It is expressed by activated T-cells and natural killer cells (NKs), as well as regulatory T-cells. It is transiently expressed on the surface of activated T-cells in acute conditions but high expression is maintained under tolerizing conditions. CD223 deficiency results in reduced tumor growth. CD223 and PD-1 can act in synergy and reverse exhausted phenotypes, improve tumor rejection, and control viral load.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human LAG-3 transfected cells.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The staining of clone 11C3C65 cannot be blocked by clone 7H2C65, which is another anti-human CD223 (LAG-3) antibody.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2892449 (BioLegend Cat. No. 369339)

Antigen Details

Structure
70 kD transmembrane glycoprotein, Ig superfamily, highly homologous to CD4.
Distribution

Activated T-cells and natural killer cells (NKs) and regulatory T cells.

Function
Negatively regulates T-cell activation.
Ligand/Receptor
Binds MHC class II molecules.
Cell Type
Dendritic cells, NK cells, T cells, Tregs
Biology Area
Immunology, Inhibitory Molecules
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Castelli C, et al. 2014. Oncoimmunology. 3(11):e967146.
2. Poirier N, et al. 2011. Clin. Exp. Immunol. 164:265.
3. Juno JA, et al. 2015. Retrovirology. 12:17.
4. Casati C, et al. 2006. Cancer Res. 66:4450.

Gene ID
3902 View all products for this Gene ID
UniProt
View information about CD223 on UniProt.org

Other Formats

View All CD223 (LAG-3) Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD223 (LAG-3) 11C3C65 FC
Alexa Fluor® 647 anti-human CD223 (LAG-3) 11C3C65 FC
PE anti-human CD223 (LAG-3) 11C3C65 FC
FITC anti-human CD223 (LAG-3) 11C3C65 FC
PE/Cyanine7 anti-human CD223 (LAG-3) 11C3C65 FC
PerCP/Cyanine5.5 anti-human CD223 (LAG-3) 11C3C65 FC
Brilliant Violet 421™ anti-human CD223 (LAG-3) 11C3C65 FC
Brilliant Violet 650™ anti-human CD223 (LAG-3) 11C3C65 FC
Brilliant Violet 510™ anti-human CD223 (LAG-3) 11C3C65 FC
Brilliant Violet 785™ anti-human CD223 (LAG-3) 11C3C65 FC
Brilliant Violet 711™ anti-human CD223 (LAG-3) 11C3C65 FC
Brilliant Violet 605™ anti-human CD223 (LAG-3) 11C3C65 FC
Alexa Fluor® 488 anti-human CD223 (LAG-3) 11C3C65 FC
Biotin anti-human CD223 (LAG-3) 11C3C65 FC
PE/Dazzle™ 594 anti-human CD223 (LAG-3) 11C3C65 FC
APC/Fire™ 750 anti-human CD223 (LAG-3) 11C3C65 FC
TotalSeq™-A0152 anti-human CD223 (LAG-3) 11C3C65 PG
TotalSeq™-C0152 anti-human CD223 (LAG-3) 11C3C65 PG
TotalSeq™-B0152 anti-human CD223 (LAG-3) 11C3C65 PG
TotalSeq™-D0152 anti-human CD223 (LAG-3) 11C3C65 PG
Alexa Fluor® 700 anti-human CD223 (LAG-3) 11C3C65 FC
Pacific Blue™ anti-human CD223 (LAG-3) 11C3C65 FC
PE/Cyanine5 anti-human CD223 (LAG-3) 11C3C65 FC
APC/Cyanine7 anti-human CD223 (LAG-3) 11C3C65 FC
APC/Fire™ 810 anti-human CD223 (LAG-3) 11C3C65 FC
Brilliant Violet 750™ anti-human CD223 (LAG-3) 11C3C65 FC
Spark Red™ 718 anti-human CD223 (LAG-3) (Flexi-Fluor™) 11C3C65 FC
Spark PLUS UV395™ anti-human CD223 (LAG-3) 11C3C65 FC
Spark Blue™ 574 anti-human CD223 (LAG-3) (Flexi-Fluor™) 11C3C65 FC
Spark PLUS B550™ anti-human CD223 (LAG-3) Antibody 11C3C65 FC
Go To Top Version: 1    Revision Date: 06/03/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account