- Clone
- Bu32 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V CD21.4, VI CD21.5
- Other Names
- Complement C3d receptor (C3dR), complement receptor 2 (CR2), Epstein-Barr virus receptor
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AACCTAGTAGTTCGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
354931 | 10 µg | 287€ |
CD21 is a 145 kD transmembrane protein also known as complement C3d receptor (C3dR), complement receptor 2 (CR2), and Epstein-Barr virus receptor. CD21 is expressed on B cells, follicular dendritic cells, subsets of normal thymocytes and T cells, and some epithelial cells. CD21 is the receptor used by Epstein-Barr virus to infect B cells and is also the complement receptor for C3d. CD21 has also been shown to interact with a number of proteins, including CD23, CD19, annexin VI, CD81, iC3b, complement receptor 1 (CR1, CD35), and interferon-alpha 1 (IFN-α1).
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections4.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Björck P, et al. 1993. Eur. J. Immunol. 23:1771.
- Frémeaux-Bacchi V, et al. 1996. Eur. J. Immunol. 26:1497.
- Ling NR, et al. 1995. Clin. Exp. Immunol. 101:369.
- Wang, C, et al. 2011. BMC Immunol. 12:53. (IHC)
- RRID
-
AB_2924554 (BioLegend Cat. No. 354931)
Antigen Details
- Structure
- Transmembrane protein, multiple SUSHI domains, approximate molecular weight 145 kD
- Distribution
-
Expressed on B cells, follicular dendritic cells, subsets of normal thymocytes and T cells, some epithelial cells
- Function
- Epstein-Barr virus receptor on B cells used for infection
- Interaction
- CD23, CD19, complement component 3, annexin VI, CD81, iC3b, complement receptor 1, interferon alpha 1
- Ligand/Receptor
- C3d, EBV
- Cell Type
- B cells, Dendritic cells, Epithelial cells, T cells, Thymocytes
- Biology Area
- Cell Biology, Complement, Costimulatory Molecules, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
- Molecular Family
- CD Molecules
- Antigen References
-
1. Kishimoto T, Eds. 1997. Leukocyte Typing VI. Garland Publishing Inc.
2. Moore MD, et al. 1987. Proc. Natl. Acad. Sci. USA 84:9194.
3. Szakonyi G, et al. 2001. Science 292:1725.
4. Weis JJ, et al. 1984. Proc. Natl. Acad. Sci. USA 81:881. - Gene ID
- 1380 View all products for this Gene ID
- UniProt
- View information about CD21 on UniProt.org
Related FAQs
Other Formats
View All CD21 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD21 | Bu32 | FC,IHC-F,IHC-P |
PE anti-human CD21 | Bu32 | FC |
APC anti-human CD21 | Bu32 | FC |
PerCP/Cyanine5.5 anti-human CD21 | Bu32 | FC |
FITC anti-human CD21 | Bu32 | FC |
PE/Cyanine7 anti-human CD21 | Bu32 | FC |
Biotin anti-human CD21 | Bu32 | FC |
TotalSeq™-A0181 anti-human CD21 | Bu32 | PG |
APC/Fire™ 750 anti-human CD21 | Bu32 | FC |
Alexa Fluor® 700 anti-human CD21 | Bu32 | FC |
PE/Dazzle™ 594 anti-human CD21 | Bu32 | FC |
TotalSeq™-C0181 anti-human CD21 | Bu32 | PG |
TotalSeq™-B0181 anti-human CD21 Antibody | Bu32 | PG |
APC/Cyanine7 anti-human CD21 | Bu32 | FC |
TotalSeq™-D0181 anti-human CD21 | Bu32 | PG |
TotalSeq™-Bn0181 anti-human CD21 | Bu32 | SB |
APC/Fire™ 750 anti-human CD21 | Bu32 | FC |
Alexa Fluor® 594 anti-human CD21 | Bu32 | IHC-P |
Spark Violet™ 423 anti-human CD21 | Bu32 | FC |
Spark Red™ 718 anti-human CD21 (Flexi-Fluor™) | Bu32 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD21
Human peripheral blood lymphocytes were stained with purifie... IHC staining of purified anti-human CD21 antibody (clone Bu3... -
PE anti-human CD21
Human peripheral blood lymphocytes were stained with CD19 Pe... -
APC anti-human CD21
Human peripheral blood lymphocytes were stained with CD19 FI... -
PerCP/Cyanine5.5 anti-human CD21
Human peripheral blood lymphocytes were stained with CD19 AP... -
FITC anti-human CD21
Human peripheral blood lymphocytes were stained with CD19 Br... -
PE/Cyanine7 anti-human CD21
Human peripheral blood lymphocytes were stained with CD19 Br... -
Biotin anti-human CD21
Human peripheral blood lymphocytes were stained with CD19 AP... -
TotalSeq™-A0181 anti-human CD21
-
APC/Fire™ 750 anti-human CD21
Human peripheral blood lymphocytes were stained with CD19 BV... -
Alexa Fluor® 700 anti-human CD21
Human peripheral blood lymphocytes were stained with CD19 BV... -
PE/Dazzle™ 594 anti-human CD21
Human peripheral blood lymphocytes were stained with CD19 BV... -
TotalSeq™-C0181 anti-human CD21
-
TotalSeq™-B0181 anti-human CD21 Antibody
-
APC/Cyanine7 anti-human CD21
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-D0181 anti-human CD21
-
TotalSeq™-Bn0181 anti-human CD21
-
APC/Fire™ 750 anti-human CD21
Typical results from human peripheral blood lymphocytes stai... -
Alexa Fluor® 594 anti-human CD21
Human paraffin-embedded tonsil tissue slices were prepared w... Human paraffin-embedded brain tissue slices were prepared wi... -
Spark Violet™ 423 anti-human CD21
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Red™ 718 anti-human CD21 (Flexi-Fluor™)
Follow Us