TotalSeq™-D0935 anti-human CD74 Antibody

Pricing & Availability
Clone
LN2 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
MHC Class II associated invariant chain, invariant chain, Ii, MHC class II chaperone, MIF receptor
Isotype
Mouse IgG1, κ
Barcode Sequence
CTGTAGCATTTCCCT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
326815 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD74 is a type II transmembrane glycoprotein also known as MHC class II associated invariant chain, invariant chain, Ii, MHC class II chaperone, and MIF receptor. CD74 exists in four isoforms with molecular masses of 33, 35, 41, and 43 kD, depending on genetic splicing. CD74 is primarily expressed on antigen presenting cells, including B cells, monocytes/macrophages, dendritic cells, and Langerhans cells. It is also expressed by activated T cells and activated endothelial and epithelial cells as well as carcinomas of lung, renal, gastric and thymic origin. The primary function of CD74 is intracellular sorting of MHC class II molecules and regulation of exogenous peptide loading onto MHC class II. It is also involved in the modulation of B cell differentiation and positive selection of CD4+ T cells. It has been reported that CD74 binds MIF (macrophage migration inhibitory factor) and signals through CD44 to regulate innate and adaptive immunity. It is also reported that H. pylori infection occurs through urease B binding of CD74 on gastric epithelial cells, inducing gastric epithelial cell apoptosis, NF-κB activation, and IL-8 production.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
SU-DHL-4 cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone LN2 is reactive with an epitope residing within 60 amino acids of the extracytoplasmic, COOH terminus of the protein.3

Additional reported applications (for the relevant formats) include: immunohistochemical staining1,2 of frozen sections and formalin-fixed paraffin-embedded sections1,2, immunoprecipitation1, and immunofluorescence4.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Epstein AL, et al.1984. J. Immunol. 133:1028. (IHC, IP)
  2. Marder RJ, et al. 1985. Lab. Invest. 52:497. (IHC)
  3. Wraight CJ, et al. 1990. J. Biol. Chem. 265:5787.
  4. Leng L, et al. 2003. J. Exp. Med. 197:1467. (IF)
RRID
AB_2904347 (BioLegend Cat. No. 326815)

Antigen Details

Structure
Type II transmembrane glycoprotein, 33, 35, 41, 43 kD
Distribution

B cells and other antigen presenting cells, activated T cells, activated endothelial and epithelial cells, and certain carcinomas

Function
Regulates loading of exogenous peptides onto MHC class II and B cell differentiation, involved in positive selection of CD4+ T cells.
Ligand/Receptor
HLA-DR, MIF, H. pylori urease B, associates with CD44
Cell Type
Antigen-presenting cells, B cells, Endothelial cells, Epithelial cells, T cells, Tregs
Biology Area
Immunology
Molecular Family
CD Molecules, MHC Antigens
Antigen References

1. Moldenhauer G, et al. 1999. Immunology 96:473.
2. Shi X, et al. 2006. Immunity 25:595.
3. Beswick EJ, et al. 2006. Infect. Immun. 74:1148.
4. Zola H,et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers Wiley-Liss A John Wiley & Sons Inc, Publication

Gene ID
972 View all products for this Gene ID
UniProt
View information about CD74 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/15/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account