Loading...

TotalSeq™-D0985 anti-human CD360 (IL-21R) Antibody

Pricing & Availability
Clone
17A12 (See other available formats)
Regulatory Status
RUO
Other Names
IL-21 Receptor, novel interleukin receptor (NILR), MGC10967
Isotype
Mouse IgG1, κ
Barcode Sequence
GAGGATGATGCCATG
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
359521 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Human interleukin 21 receptor (IL-21R) is a single pass type I membrane protein and a member of the type I cytokine receptor family. Of the type I cytokine receptors, IL-21R exhibits greatest extracellular homology to the IL-2R beta subunit (i.e., it contains one copy of the WSXWS-containing cytokine-binding domain). Intracellular domains of IL-21R include the Box 1 and Box 2 elements, which are similar to the IL-9R intracellular region. Upon binding IL-21, IL-21R forms a heterodimer with the common gamma subunit (CD132) and induces Jak/Stat signaling. IL-21R is expressed on B cells and at various levels on NK and T cells. IL-21 is a potent immunomodulatory cytokine mainly produced by NKT and CD4 T-cells (particularly the inflammatory Th17 subset) and has pleiotropic effects on both innate and adaptive immune responses. These actions include positive effects such as enhanced proliferation of natural killer (NK) cells and cytotoxic T cells that can destroy virally infected or cancerous cells and direct inhibitory effects on the antigen-presenting function of dendritic cells, and can be proapoptotic for B cells and NK cells. Studies have shown that IL-21 is also an autocrine cytokine that potently induces Th17 differentiation and suppresses Foxp3 expression, and serves as a target for treating inflammatory diseases.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human IL-21R expressing mouse M1-T22 cell line.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

 


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunofluorescent surface staining1.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Bannantine J, et al. 2011. Front Microbiol. 2:163. (IF)
RRID
AB_2904382 (BioLegend Cat. No. 359521)

Antigen Details

Structure
Single pass type I membrane protein, extracellular WSXWS-containing cytokine-binding domain, intracellular Box1 and Box2 domains
Distribution

B cells, various levels on NK cells, T cells, NKT cells, B cells, DCs, macrophages, non-hematopoietic cells, including keratinocytes and fibroblasts

Ligand/Receptor
IL-21
Cell Type
B cells, Dendritic cells, Fibroblasts, Macrophages, NK cells, NKT cells, T cells, Tregs
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Parrish-Novak J, et al. 2002. J. Leukocyte Biol. 72:856.
2. de Totero D, et al. 2006. Blood 107:3708. 
3. Asao H, et al. 2001. J. Immunol. 167:1.
4. Davis ID, et al. 2007. Clin. Cancer Res. 13:6926. 
5. Nurieva R. 2007. Nature. 448:480.
6. Dumoutier L, et al. 2000. Proc. Natl. Acad. Sci. USA 97:10144.
7. Ozaki, K, et al. 2000. Proc. Natl. Acad. Sci. USA 97:11439.
8. Parrish-Novak J, et al. 2000. Nature 408:57.
9. Spolski R and Leonard WJ. et al. 2008. Annu. Rev. Immunol. 26:57.

Gene ID
50615 View all products for this Gene ID
UniProt
View information about CD360 on UniProt.org
Go To Top Version: 0    Revision Date: 09/22/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account