TotalSeq™-D0081 anti-human CD14 Antibody

Pricing & Availability
Clone
M5E2 (See other available formats)
Regulatory Status
RUO
Workshop
III 329
Other Names
LPS receptor
Isotype
Mouse IgG2a, κ
Barcode Sequence
TCTCAGACCTCCGTA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
301865 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD14 is a 53-55 kD glycosylphosphatidylinositol (GPI)-linked membrane glycoprotein also known as LPS receptor. CD14 is expressed at high levels on monocytes and macrophages, and at lower levels on granulocytes. Some dendritic cell populations such as interfollicular dendritic cells, reticular dendritic cells, and Langerhans cells have also been reported to express CD14. As a high-affinity receptor for LPS, CD14 is involved in the clearance of gram-negative pathogens, and in the upregulation of adhesion molecules and expression of cytokines in monocytes and neutrophils.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Capuchin Monkey, Cow, Chimpanzee, Common Marmoset, Cotton-topped Tamarin, Dog, Pigtailed Macaque, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Full-length human CD14 protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The M5E2 antibody inhibits monocyte activation and cytokine production induced by LPS. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections, blocking of LPS stimulation4, and immunofluorescence microscopy5. Clone M5E2 is not recommended for immunohistochemical staining of formalin-fixed paraffin-embedded sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 301861 and 301862).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. McMichael A, et al. 1987. Leucocyte Typing III. Oxford University Press. New York.
  2. Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York. (IHC-F)
  3. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  4. Power CP, et al. 2004. J. Immunol. 173:5229. (Block)
  5. Williams KC, et al. 2001. J. Exp. Med. 193:905.
  6. Iwamoto S, et al. 2007. J. Immunol. 179:1449. (FC) PubMed
  7. Santer DM, et al. 2010. J. Immunol. 485:4739. PubMed
  8. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  9. Zizzo G, et al. 2012. J. Immunol. 189:3508. PubMed
  10. Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
  11. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID
AB_2892347 (BioLegend Cat. No. 301865)

Antigen Details

Structure
GPI-linked membrane glycoprotein, 53-55 kD
Distribution

Monocytes, macrophages, granulocytes (low)

Function
LPS receptor, clearance of Gram-negative pathogens
Ligand/Receptor
LPS
Cell Type
Granulocytes, Macrophages, Monocytes, Neutrophils
Biology Area
Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family
CD Molecules
Antigen References

1. Stocks S, et al. 1990. Biochem. J. 268:275.
2. Wright S, et al. 1990. Science 249:1434.

Gene ID
929 View all products for this Gene ID
UniProt
View information about CD14 on UniProt.org

Other Formats

View All CD14 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD14 M5E2 FC
FITC anti-human CD14 M5E2 FC
PE anti-human CD14 M5E2 FC
Purified anti-human CD14 M5E2 FC,CyTOF®,Block,IHC-F
PE/Cyanine7 anti-human CD14 M5E2 FC
Alexa Fluor® 488 anti-human CD14 M5E2 FC
Alexa Fluor® 647 anti-human CD14 M5E2 FC
Ultra-LEAF™ Purified anti-human CD14 M5E2 FC,CyTOF®,Block,IHC-F
Pacific Blue™ anti-human CD14 M5E2 FC
APC/Cyanine7 anti-human CD14 M5E2 FC
Alexa Fluor® 700 anti-human CD14 M5E2 FC
PerCP/Cyanine5.5 anti-human CD14 M5E2 FC
Biotin anti-human CD14 M5E2 FC
Brilliant Violet 421™ anti-human CD14 M5E2 FC
Brilliant Violet 570™ anti-human CD14 M5E2 FC
Brilliant Violet 605™ anti-human CD14 M5E2 FC
Brilliant Violet 650™ anti-human CD14 M5E2 FC
Brilliant Violet 711™ anti-human CD14 M5E2 FC
Brilliant Violet 785™ anti-human CD14 M5E2 FC
Brilliant Violet 510™ anti-human CD14 M5E2 FC
Purified anti-human CD14 (Maxpar® Ready) M5E2 FC,CyTOF®
PerCP anti-human CD14 M5E2 FC
FITC anti-human CD14 M5E2 FC
PE/Dazzle™ 594 anti-human CD14 M5E2 FC
Pacific Blue™ anti-human CD14 M5E2 FC
APC/Fire™ 750 anti-human CD14 M5E2 FC
APC anti-human CD14 M5E2 FC
TotalSeq™-A0081 anti-human CD14 M5E2 PG
TotalSeq™-B0081 anti-human CD14 M5E2 PG
TotalSeq™-C0081 anti-human CD14 M5E2 PG
PE anti-human CD14 M5E2 FC
PE/Cyanine5 anti-human CD14 M5E2 FC
TotalSeq™-D0081 anti-human CD14 M5E2 PG
APC/Fire™ 750 anti-human CD14 M5E2 FC
GMP FITC anti-human CD14 M5E2 FC
PE/Cyanine7 anti-human CD14 M5E2 FC
GMP APC anti-human CD14 M5E2 FC
GMP PE anti-human CD14 M5E2 FC
PE/Dazzle™ 594 anti-human CD14 M5E2 FC
GMP Pacific Blue™ anti-human CD14 M5E2 FC
GMP APC/Fire™ 750 anti-human CD14 M5E2 FC
PerCP/Cyanine5.5 anti-human CD14 M5E2 FC
Spark Violet™ 500 anti-human CD14 M5E2 FC
GMP PE/Dazzle™ 594 anti-human CD14 M5E2 FC
APC/Fire™ 810 anti-human CD14 M5E2 FC
PE/Fire™ 700 anti-human CD14 M5E2 FC
Go To Top Version: 1    Revision Date: 05-24-2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account