IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0095 Rat IgG2b, κ Isotype Ctrl Antibody

Pricing & Availability
Clone
RTK4530 (See other available formats)
Regulatory Status
RUO
Isotype
Rat IgG2b, κ
Barcode Sequence
GATTCTTGACGACCT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
400697 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The isotype of RTK4530 immunoglobulin is rat IgG2b, κ. This antibody was chosen as an isotype control after screening on a variety of resting, activated, live, and fixed mouse, rat and human tissues.

Product Details
Technical Data Sheet (pdf)

Product Details

Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Trinitrophenol + KLH
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The RTK4530 immunoglobulin is useful as an isotype-matched control (for the relevant formats) for Western blotting, immunoprecipitation, immunohistochemistry, functional assay, and immunofluorescence microscopy. The Ultra-LEAF™ purified antibody (Endotoxin <  0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 400643, 400644, 400671, 400672, 400675, and 400676) as negative control.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Cervantes-Barragan L, et al. 2007. Blood 109:1131.
  2. Zeiser R, et al. 2007. Blood 109:2225.
  3. Sasaki K, et al. 2008. J. Immunol. 181:104. PubMed
  4. Duan J, et al. 2008. P. Natl. Acad. Sci. USA 105:5183. PubMed
  5. Yi H, et al. 2009. Blood 113:5819. PubMed
  6. Schafeer JS, et al. 2010. J. Leukocyte Biol. 87:301. PubMed
  7. Lei GS, et al. 2015. Infect Immun. 83:572. PubMed
  8. Richards J, et al. 2015. Mol Cell Cardiol. 79:21. PubMed
RRID
AB_3097167 (BioLegend Cat. No. 400697)

Antigen Details

Gene ID
NA

Related FAQs

There are no FAQs for this product.

Other Formats

View All Reagents Request Custom Conjugation
Description Clone Applications
APC Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Biotin Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
FITC Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
PE Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
PE/Cyanine5 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Purified Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC,ICC,IHC,IP,WB
PE/Cyanine7 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
APC/Cyanine7 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Alexa Fluor® 647 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Alexa Fluor® 488 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Pacific Blue™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Alexa Fluor® 700 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
PerCP Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
PerCP/Cyanine5.5 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Brilliant Violet 421™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Brilliant Violet 570™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Ultra-LEAF™ Purified Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC,ICC,IHC,IP,WB,FA
Brilliant Violet 510™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Brilliant Violet 605™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Brilliant Violet 785™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Brilliant Violet 650™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
Brilliant Violet 711™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
PE/Dazzle™ 594 Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Alexa Fluor® 594 Rat IgG2b, κ Isotype Ctrl RTK4530 IHC-F
GoInVivo™ Purified Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC,ICC,IHC,IP,WB,FA
APC/Fire™ 750 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
TotalSeq™-A0095 Rat IgG2b, κ Isotype Ctrl RTK4530 PG
TotalSeq™-C0095 Rat IgG2b, κ Isotype Ctrl RTK4530 PG
KIRAVIA Blue 520™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Spark Blue™ 550 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
PE/Fire™ 640 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
APC/Fire™ 810 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
PE/Fire™ 700 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
TotalSeq™-B0095 Rat IgG2b, κ Isotype Ctrl RTK4530 PG
TotalSeq™-D0095 Rat IgG2b, κ Isotype Ctrl RTK4530 PG
PE/Fire™ 810 Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Brilliant Violet 750™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Spark YG™ 570 Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Spark NIR™ 685 Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Spark Blue™ 574 Rat IgG2b, κ Isotype Ctrl RTK4530 FC
PerCP/Fire™ 806 Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Spark Blue™ 515 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
PerCP/Fire™ 780 Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Spark Red™ 718 Rat IgG2b, κ Isotype Ctrl RTK4530 FC,ICFC
TotalSeq™-Bn0095 Rat IgG2b, κ Isotype Ctrl RTK4530 SB
Spark Violet™ 538 Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Spark UV™ 387 Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Spark PLUS UV395™ Rat IgG2b, κ Isotype Ctrl RTK4530 FC
PE/Fire™ 744 Rat IgG2b, κ Isotype Ctrl RTK4530 FC
Go To Top Version: 1    Revision Date: 04-17-2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC Rat IgG2b, κ Isotype Ctrl

  • Biotin Rat IgG2b, κ Isotype Ctrl

  • FITC Rat IgG2b, κ Isotype Ctrl

  • PE Rat IgG2b, κ Isotype Ctrl

  • PE/Cyanine5 Rat IgG2b, κ Isotype Ctrl

  • Purified Rat IgG2b, κ Isotype Ctrl

  • PE/Cyanine7 Rat IgG2b, κ Isotype Ctrl

  • APC/Cyanine7 Rat IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 647 Rat IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 488 Rat IgG2b, κ Isotype Ctrl

  • Pacific Blue™ Rat IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 700 Rat IgG2b, κ Isotype Ctrl

    RTK4530_Alx700_080408.jpg
    CD57BL/6 mouse splenocytes stained with RTK4530 Alexa Fluor®...
  • PerCP Rat IgG2b, κ Isotype Ctrl

  • PerCP/Cyanine5.5 Rat IgG2b, κ Isotype Ctrl

  • Brilliant Violet 421™ Rat IgG2b, κ Isotype Ctrl

  • Brilliant Violet 570™ Rat IgG2b, κ Isotype Ctrl

  • Ultra-LEAF™ Purified Rat IgG2b, κ Isotype Ctrl

  • Brilliant Violet 510™ Rat IgG2b, κ Isotype Ctrl

  • Brilliant Violet 605™ Rat IgG2b, κ Isotype Ctrl

  • Brilliant Violet 785™ Rat IgG2b, κ Isotype Ctrl

  • Brilliant Violet 650™ Rat IgG2b, κ Isotype Ctrl

  • Brilliant Violet 711™ Rat IgG2b, κ Isotype Ctrl

  • PE/Dazzle™ 594 Rat IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 594 Rat IgG2b, κ Isotype Ctrl

  • GoInVivo™ Purified Rat IgG2b, κ Isotype Ctrl

  • APC/Fire™ 750 Rat IgG2b, κ Isotype Ctrl

  • TotalSeq™-A0095 Rat IgG2b, κ Isotype Ctrl

  • TotalSeq™-C0095 Rat IgG2b, κ Isotype Ctrl

  • KIRAVIA Blue 520™ Rat IgG2b, κ Isotype Ctrl

  • Spark Blue™ 550 Rat IgG2b, κ Isotype Ctrl

  • PE/Fire™ 640 Rat IgG2b, κ Isotype Ctrl

  • APC/Fire™ 810 Rat IgG2b, κ Isotype Ctrl

  • PE/Fire™ 700 Rat IgG2b, κ Isotype Ctrl

  • TotalSeq™-B0095 Rat IgG2b, κ Isotype Ctrl

  • TotalSeq™-D0095 Rat IgG2b, κ Isotype Ctrl

  • PE/Fire™ 810 Rat IgG2b, κ Isotype Ctrl

  • Brilliant Violet 750™ Rat IgG2b, κ Isotype Ctrl

  • Spark YG™ 570 Rat IgG2b, κ Isotype Ctrl

  • Spark NIR™ 685 Rat IgG2b, κ Isotype Ctrl

  • Spark Blue™ 574 Rat IgG2b, κ Isotype Ctrl

  • PerCP/Fire™ 806 Rat IgG2b, κ Isotype Ctrl

  • Spark Blue™ 515 Rat IgG2b, κ Isotype Ctrl

  • PerCP/Fire™ 780 Rat IgG2b, κ Isotype Ctrl

  • Spark Red™ 718 Rat IgG2b, κ Isotype Ctrl

  • TotalSeq™-Bn0095 Rat IgG2b, κ Isotype Ctrl

  • Spark Violet™ 538 Rat IgG2b, κ Isotype Ctrl

  • Spark UV™ 387 Rat IgG2b, κ Isotype Ctrl

  • Spark PLUS UV395™ Rat IgG2b, κ Isotype Ctrl

  • PE/Fire™ 744 Rat IgG2b, κ Isotype Ctrl

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account