- Clone
- 16A1 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Platelet-derived growth factor receptor, alpha polypeptide, PDGFR2, PDGFRα, PDGFRa, PDGF receptor alpha
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- ATGCGCCGAGAATTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
323517 | 10 µg | 287€ |
The 16A1 monoclonal antibody recognizes human CD140a also known as the platelet-derived growth factor receptor, alpha polypeptide, PDGFR2, and PDGFRα. CD140a is a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. The identity of the growth factor bound to the receptor determines whether the functional receptor is a homodimer or heterodimer composed of both PDGFR-α and -β. CD140a contains three immunoglobulin-like domains and a tyrosine kinase domain with a predicted molecular weight of approximately 123 kD. CD140a is widely expressed on a variety of mesenchymal-derived cells and has been implicated in the development of some tumors including basal cell carcinoma and gastric stromal cell tumors. Binding of A-chain containing PDGF molecules as well as protease-activated PDGF-C molecules can stimulate cell proliferation. CD140a has been shown to interact with a number of proteins including CRK, Grb2, Grb14, SHP2, and others as integrin β3, caveolin-1, and nexin sorting molecules. The PDGFRα is heavily phosphorylated on numerous tyrosine residues through both autophosphorylation and ligand-dependent processes. The 16A1 antibody has been shown to be useful for flow cytometric detection of CD140a.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- NIH 3T3 cells transfected with human PDGFRalpha
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
- RRID
-
AB_2927874 (BioLegend Cat. No. 323517)
Antigen Details
- Structure
- Cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family.
- Distribution
-
Widely expressed on a variety of mesenchymal-derived cells.
- Function
- Stimulation of cell proliferation; mitogenic activity for cells of mesenchymal origin. Knock-out studies have implicated an essential role for CD140a in kidney development. Has been implicated in basal cell carcinoma and gastric stromal cell tumors.
- Interaction
- Interacts with Crk, as well as a variety of adaptor molecules and signaling intermediates (Grb2, Grb14, SHP2, others). Has also been shown to associate with integrin β3, caveolin-1, and nexin sorting molecules
- Ligand/Receptor
- Binds to A-chain containing PDGF molecules and protease-activated PDGF-C molecules
- Modification
- Multiple tyrosine phosphorylation sites (Y720, Y731, Y742, Y754, Y762, Y767, Y768, Y988, Y993, Y1018)
- Cell Type
- Embryonic Stem Cells, Mesenchymal cells, Mesenchymal Stem Cells, Neural Stem Cells
- Biology Area
- Angiogenesis, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Gronwald RG, et al. 1988. Proc. Natl. Acad. Sci. USA 85:3435.
2. Gilbertson DG, et al. 2001. J. Biol. Chem. 276:27406.
3. Seifert RA, et al. 1989. J. Biol. Chem. 264:8771.
4. Rupp E, et al. 1994. Eur. J. Biochem. 225:29. - Gene ID
- 5156 View all products for this Gene ID
- UniProt
- View information about CD140a on UniProt.org
Related Pages & Pathways
Pages
Other Formats
View All CD140a Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD140a (PDGFRα) | 16A1 | FC,ICC |
Biotin anti-human CD140a (PDGFRα) | 16A1 | FC |
PE anti-human CD140a (PDGFRα) | 16A1 | FC |
PE/Cyanine7 anti-human CD140a (PDGFRα) | 16A1 | FC |
TotalSeq™-A0128 anti-human CD140a (PDGFRα) | 16A1 | PG |
APC anti-human CD140a (PDGFRα) | 16A1 | FC |
TotalSeq™-C0128 anti-human CD140a (PDGFRα) | 16A1 | PG |
TotalSeq™-B0128 anti-human CD140a (PDGFRα) | 16A1 | PG |
TotalSeq™-D0128 anti-human CD140a (PDGFRα) | 16A1 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD140a (PDGFRα)
-
Biotin anti-human CD140a (PDGFRα)
-
PE anti-human CD140a (PDGFRα)
-
PE/Cyanine7 anti-human CD140a (PDGFRα)
-
TotalSeq™-A0128 anti-human CD140a (PDGFRα)
-
APC anti-human CD140a (PDGFRα)
-
TotalSeq™-C0128 anti-human CD140a (PDGFRα)
-
TotalSeq™-B0128 anti-human CD140a (PDGFRα)
-
TotalSeq™-D0128 anti-human CD140a (PDGFRα)
Follow Us