TotalSeq™-D0136 anti-human IgM Antibody, IgM, MHM-88

Pricing & Availability

Clone: MHM-88 (See other available formats)
Regulatory Status: RUO
Other Names: Immunoglobulin M
Isotype: Mouse IgG1, κ
Barcode Sequence: TAGCGAGCCCGTATA
Ave. Rating: Submit a Review
Product Citations: publications

Compare all formats

Cat #

Size

Price

Quantity Check Availability

Save

314553

10 µg

296€

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

IgM is the first immunoglobulin made by B cells in the immune response. Surface IgM is expressed on immature and mature B cells, while IgM heavy (μ) chain is expressed intracellularly in pre-B cells.

Product Details

Technical Data Sheet (pdf)

Product Details

Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human Ig cocktail
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: MHM-88 antibody reacts with both soluble and membrane human immunoglobulin M (IgM). It does not react with other Ig isotypes. Additional reported applications (for the relevant formats) include: use as a primary or secondary reagent for ELISA analysis.

Due to the presence of excess soluble IgM in whole blood, which competes for antibody binding, staining for IgM on cells in whole blood is not recommended.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2922547 (BioLegend Cat. No. 314553)

Antigen Details

Structure: Ig family
Distribution: B cells
Function: B cell differentiation, humoral immune response; cross-linking surface IgM induces apoptosis
Cell Type: B cells
Biology Area: Immunology
Gene ID: 3507 View all products for this Gene ID
UniProt: View information about IgM on UniProt.org

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Other Formats

View All IgM Reagents Request Custom Conjugation

Description	Clone	Applications
Purified anti-human IgM	MHM-88	FC,ELISA
PE anti-human IgM	MHM-88	FC
Biotin anti-human IgM	MHM-88	FC,ELISA
FITC anti-human IgM	MHM-88	FC
APC anti-human IgM	MHM-88	FC
PerCP/Cyanine5.5 anti-human IgM	MHM-88	FC
Pacific Blue™ anti-human IgM	MHM-88	FC
Brilliant Violet 421™ anti-human IgM	MHM-88	FC
APC/Cyanine7 anti-human IgM	MHM-88	FC
Brilliant Violet 570™ anti-human IgM	MHM-88	FC
Brilliant Violet 510™ anti-human IgM	MHM-88	FC
Brilliant Violet 605™ anti-human IgM	MHM-88	FC
Brilliant Violet 650™ anti-human IgM	MHM-88	FC
Purified anti-human IgM (Maxpar® Ready)	MHM-88	FC,CyTOF®
PE/Dazzle™ 594 anti-human IgM	MHM-88	FC
PE/Cyanine7 anti-human IgM	MHM-88	FC
Alexa Fluor® 488 anti-human IgM	MHM-88	FC
Alexa Fluor® 647 anti-human IgM	MHM-88	FC
Alexa Fluor® 700 anti-human IgM	MHM-88	FC
Brilliant Violet 711™ anti-human IgM	MHM-88	FC
TotalSeq™-A0136 anti-human IgM	MHM-88	PG
TotalSeq™-C0136 anti-human IgM	MHM-88	PG
Brilliant Violet 785™ anti-human IgM	MHM-88	FC
APC/Fire™ 750 anti-human IgM	MHM-88	FC
TotalSeq™-B0136 anti-human IgM	MHM-88	PG
Spark Violet™ 423 anti-human IgM Antibody	MHM-88	FC
TotalSeq™-D0136 anti-human IgM	MHM-88	PG
Spark Blue™ 550 anti-human IgM	MHM-88	FC
Spark Blue™ 515 anti-human IgM	MHM-88	FC
PE/Fire™ 700 anti-human IgM	MHM-88	FC
Spark YG™ 593 anti-human IgM	MHM-88	FC
PE/Fire™ 640 anti-human IgM	MHM-88	FC
Spark Red™ 718 anti-human IgM (Flexi-Fluor™)	MHM-88	FC
APC anti-human IgM	MHM-88	FC
PE anti-human IgM	MHM-88	FC
Brilliant Violet 750™ anti-human IgM	MHM-88	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 03-18-2022

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.