TotalSeq™-D0162 anti-human CD64 Antibody

Pricing & Availability
Clone
10.1 (See other available formats)
Regulatory Status
RUO
Workshop
VI MA36
Other Names
FcγRI, FcR I
Isotype
Mouse IgG1, κ
Barcode Sequence
AAGTATGCCCTACGA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
305051 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD64 is a 72 kD single chain type I glycoprotein also known as FcγRI and FcR I. CD64 is a member of the immunoglobulin superfamily and is expressed on monocytes/macrophages, dendritic cells, and activated granulocytes. The expression can be upregulated by IFN-γ stimulation. CD64 binds IgG immune complex. It plays a role in antigen capture, phagocytosis of IgG/antigen complexes, and antibody-dependent cellular cytotoxicity (ADCC).

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
Baboon, Capuchin Monkey, Chimpanzee, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human rheumatoid synovial fluid cells and fibronectin-purified monocytes.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone 10.1 recognizes the EC3 epitope of CD64. While both contain the EC3 domain, in-house testing suggests that clone 10.1 preferentially binds to CD64A (FcγRIA), but not CD64B (FcγRIB). Additional reported applications (for the relevant formats) include: blocking of human IgG3 and murine IgG2a binding to FcγRI2,5,6,11 and immunohistochemical staining of acetone-fixed frozen tissue sections12.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. McMichael A, et al. Eds. 1987. Leucocyte Typing III. Oxford University Press. New York.
  2. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. p. 874.
  3. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
  4. Holl V, et al. 2004. J. Immunol. 173:6274.
  5. Hober D, et al. 2002. J. Gen. Virol. 83:2169.
  6. Cho HJ, et al. 2007. Physiol Genomics 149:60.
  7. van Tits L, et al. 2005. Arterioscler Thromb Vasc Biol. 25:717. PubMed
  8. Bruhns P, et al. 2008. Blood 113:3716. PubMed
  9. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  10. Carter DL, et al. 1999. Cytometry 37:41. (FC)
  11. Dougherty GJ, et al. 1987. Eur. J. Immunol. 17:1453.
  12. Blom AB, et al. 2003. Arthritis Rheum. 48(4):1002-14. (IHC)
RRID
AB_2892360 (BioLegend Cat. No. 305051)

Antigen Details

Structure
Ig superfamily, type I glycoprotein, 72 kD
Distribution

Monocytes, macrophages, dendritic cells, activated granulocytes

Function
Phagocytosis, ADCC
Ligand/Receptor
IgG receptor
Cell Type
Dendritic cells, Granulocytes, Macrophages, Monocytes
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, Fc Receptors
Antigen References

1. Hulett M, et al. 1994. Adv. Immunol. 57:1.
2. van de Winkel J, et al. 1993. Immunol. Today 14:215.

Gene ID
2209 View all products for this Gene ID
UniProt
View information about CD64 on UniProt.org

Related FAQs

Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?

Yes

Other Formats

View All CD64 Reagents Request Custom Conjugation
Description Clone Applications
Biotin anti-human CD64 10.1 FC
FITC anti-human CD64 10.1 FC
PE anti-human CD64 10.1 FC
Purified anti-human CD64 10.1 FC,IHC-F,Block
Alexa Fluor® 488 anti-human CD64 10.1 FC
Alexa Fluor® 647 anti-human CD64 10.1 FC
APC anti-human CD64 10.1 FC
Pacific Blue™ anti-human CD64 10.1 FC
Brilliant Violet 421™ anti-human CD64 10.1 FC
PE/Cyanine7 anti-human CD64 10.1 FC
PerCP/Cyanine5.5 anti-human CD64 10.1 FC
APC/Cyanine7 anti-human CD64 10.1 FC
Brilliant Violet 510™ anti-human CD64 10.1 FC
Purified anti-human CD64 (Maxpar® Ready) 10.1 FC,CyTOF®
PE/Dazzle™ 594 anti-human CD64 10.1 FC
Brilliant Violet 605™ anti-human CD64 10.1 FC
APC/Fire™ 750 anti-human CD64 10.1 FC
PE anti-human CD64 10.1 FC
PE/Dazzle™ 594 anti-human CD64 10.1 FC
FITC anti-human CD64 10.1 FC
TotalSeq™-A0162 anti-human CD64 10.1 PG
Brilliant Violet 711™ anti-human CD64 10.1 FC
Alexa Fluor® 700 anti-human CD64 10.1 FC
Brilliant Violet 785™ anti-human CD64 10.1 FC
TotalSeq™-C0162 anti-human CD64 10.1 PG
Ultra-LEAF™ Purified anti-human CD64 10.1 FC,IHC-F,Block
TotalSeq™-B0162 anti-human CD64 10.1 PG
TotalSeq™-D0162 anti-human CD64 10.1 PG
GMP PE anti-human CD64 10.1 FC
GMP FITC anti-human CD64 10.1 FC
Brilliant Violet 650™ anti-human CD64 10.1 FC
GMP PE/Dazzle™ 594 anti-human CD64 10.1 FC
PE/Cyanine7 anti-human CD64 10.1 FC
APC/Fire™ 750 anti-human CD64 10.1 FC
PerCP/Cyanine5.5 anti-human CD64 10.1 FC
Pacific Blue™ anti-human CD64 10.1 FC
GMP APC/Fire™ 750 anti-human CD64 10.1 FC
GMP PE/Cyanine7 anti-human CD64 10.1 FC
Go To Top Version: 1    Revision Date: 05-24-2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account