IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0171 anti-human/mouse/rat CD278 (ICOS) Antibody

Pricing & Availability
Clone
C398.4A (See other available formats)
Regulatory Status
RUO
Other Names
Inducible COStimulatory molecule, H4
Isotype
Armenian Hamster IgG
Barcode Sequence
CGCGCACCCATTAAA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
313561 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

ICOS, also known as inducible costimulatory molecule and H4, is a 47-57 kD protein. This protein is homologous to the CD28/CTLA-4 proteins. ICOS is expressed on activated T cells and a subset of thymocytes. It is able to costimulate T cells proliferation. In addition, ICOS is involved in humoral immune responses (B cell germinal center formation). The ICOS ligand is B7h/B7RP-1 or B7-H2. ICOS stimulation has been shown to potentiate TCR-mediated IL-4 and IL-10 production and has been proposed to play a role in Th2 cell development.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Mouse, Rat
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus, Pig
Antibody Type
Monoclonal
Host Species
Armenian Hamster
Immunogen
Mouse T cell clone D10.G4.1
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

 


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes
  1. The C398.4A antibody is useful for flow cytometric analysis and is able to costimulate T cell activation and proliferation. Additional reported applications (for the relevant formats) include: immunoprecipitation1in vitro costimulation of T cell activation1,3,4, and spatial biology (IBEX)5,6. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 313512).
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Redoglia V, et al. 1996. Eur. J. Immunol. 26:2781. (FC IP Costim)
  2. Yagi J, et al. 2003. J. Immunol. 171:783. (FC)
  3. Arimura Y, et al. 2002. Int. Immunol. 14:555. (Costim)
  4. Arimura Y, et al. 2004. J. Biol. Chem. 279:11408. (Costim)
  5. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  6. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2894687 (BioLegend Cat. No. 313561)

Antigen Details

Structure
CD28/CTLA-4, 47-57 kD
Distribution

Activated T cells, subset of thymocytes

Function
Costimulates T cell activation, proliferation, humoral immune response
Ligand/Receptor
B7h/B7RP-1/GL-50
Cell Type
T cells, Thymocytes, Tregs
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Redoglia V, et al. 1996. Eur. J. Immunol. 26:2781.
2. Hutloff A, et al. 1999. Nature 397:263.
3. Buonfiglio D, et al. 2000. Eur. J. Immunol. 30:3463.
4. Coyle AJ, et al. 2000. Immunity 13:95.

Gene ID
100048841 View all products for this Gene ID 29851 View all products for this Gene ID 64545 View all products for this Gene ID
UniProt
View information about CD278 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD278 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human/mouse/rat CD278 (ICOS) C398.4A FC,IP,Costim,SB
Biotin anti-human/mouse/rat CD278 (ICOS) C398.4A FC
FITC anti-human/mouse/rat CD278 (ICOS) C398.4A FC
PE anti-human/mouse/rat CD278 (ICOS) C398.4A FC
APC anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Alexa Fluor® 488 anti-human/mouse/rat CD278 (ICOS) C398.4A FC,SB
Alexa Fluor® 647 anti-human/mouse/rat CD278 (ICOS) C398.4A FC,IHC-F
PerCP/Cyanine5.5 anti-human/mouse/rat CD278 (ICOS) C398.4A FC
PE/Cyanine7 anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Pacific Blue™ anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Brilliant Violet 421™ anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Brilliant Violet 510™ anti-human/mouse/rat CD278 (ICOS) C398.4A FC
APC/Cyanine7 anti-human/mouse/rat CD278 (ICOS) C398.4A FC
PE/Dazzle™ 594 anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Alexa Fluor® 700 anti-human/mouse/rat CD278 (ICOS) C398.4A FC
APC/Fire™ 750 anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Brilliant Violet 785™ anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Brilliant Violet 605™ anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Ultra-LEAF™ Purified anti-human/mouse/rat CD278 (ICOS) C398.4A FC,IP,Costim
GoInVivo™ Purified anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Brilliant Violet 711™ anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Brilliant Violet 650™ anti-human/mouse/rat CD278 (ICOS) C398.4A FC
TotalSeq™-B0171 anti-human/mouse/rat CD278 (ICOS) C398.4A PG
TotalSeq™-C0171 anti-human/mouse/rat CD278 (ICOS) C398.4A PG
TotalSeq™-A0171 anti-human/mouse/rat CD278 (ICOS) C398.4A PG
Brilliant Violet 750™ anti-human/mouse/rat CD278 (ICOS) C398.4A FC
TotalSeq™-D0171 anti-human/mouse/rat CD278 (ICOS) Antibody C398.4A PG
PE/Cyanine5 anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Spark Red™ 718 anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Spark PLUS UV395™ anti-human/mouse/rat CD278 (ICOS) C398.4A FC
Go To Top Version: 1    Revision Date: 09-14-2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account