Loading...

TotalSeq™-D0236 Rat IgG1, κ Isotype Ctrl Antibody

Pricing & Availability
Clone
RTK2071 (See other available formats)
Regulatory Status
RUO
Isotype
Rat IgG1, κ
Barcode Sequence
ATCAGATGCCCTCAT
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
400485 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The isotype of RTK2071 immunoglobulin is rat IgG1, κ. This antibody was chosen as an isotype control after screening on a variety of resting, activated, live, and fixed mouse, rat and human tissues.

Product Details
Technical Data Sheet (pdf)

Product Details

Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Trinitrophenol + KLH
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The RTK2071 immunoglobulin is useful as an isotype-matched control (for the relevant formats) for Western blotting, immunoprecipitation, immunohistochemistry, functional assay, and immunofluorescence microscopy. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 400414) as negative control1. For in vivo studies or highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 400432) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin < 0.01 EU/µg).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Riemann M, et al. 2005. J. Immunol. 175:3560. PubMed
  2. Wondimu Z, et al. 2010. Am. J. Pathol. 177:2334. PubMed
RRID
AB_3097168 (BioLegend Cat. No. 400485)

Antigen Details

Gene ID
NA

Other Formats

View All Reagents Request Custom Conjugation
Description Clone Applications
APC Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Biotin Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
FITC Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
PE Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
PE/Cyanine5 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Purified Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC,ICC,IHC,IP,WB
PE/Cyanine7 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Alexa Fluor® 647 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Alexa Fluor® 488 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Pacific Blue™ Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Alexa Fluor® 700 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
APC/Cyanine7 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
PerCP Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
PerCP/Cyanine5.5 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Brilliant Violet 421™ Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Ultra-LEAF™ Purified Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC,ICC,IHC,WB,IP,FA
Brilliant Violet 605™ Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Brilliant Violet 510™ Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Brilliant Violet 650™ Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Brilliant Violet 711™ Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Brilliant Violet 785™ Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
PE/Dazzle™ 594 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Alexa Fluor® 594 Rat IgG1, κ Isotype Ctrl RTK2071 IHC-F
GoInVivo™ Purified Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC,ICC,IHC,WB,IP,FA
APC/Fire™ 750 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
TotalSeq™-A0236 Rat IgG1, κ Isotype Ctrl RTK2071 PG
KIRAVIA Blue 520™ Rat IgG1, κ Isotype Ctrl RTK2071 FC
TotalSeq™-B0236 Rat IgG1, κ Isotype Ctrl RTK2071 PG
TotalSeq™-C0236 Rat IgG1, κ Isotype Ctrl RTK2071 PG
Spark YG™ 581 Rat IgG1, κ Isotype Ctrl RTK2071 FC
Spark YG™ 593 Rat IgG1, κ Isotype Ctrl RTK2071 FC
Spark NIR™ 685 Rat IgG1, κ Isotype Ctrl RTK2071 FC
PE/Fire™ 640 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
TotalSeq™-D0236 Rat IgG1, κ Isotype Ctrl RTK2071 PG
PE/Fire™ 700 Rat IgG1, κ Isotype Ctrl RTK2071 FC
APC/Fire™ 810 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Brilliant Violet 750™ Rat IgG1, κ Isotype Ctrl RTK2071 FC
Spark YG™ 570 Rat IgG1, κ Isotype Ctrl RTK2071 FC
PerCP/Fire™ 806 Rat IgG1, κ Isotype Ctrl RTK2071 FC
PerCP/Fire™ 780 Rat IgG1, κ Isotype Ctrl RTK2071 FC
Spark Red™ 718 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
TotalSeq™-Bn0236 Rat IgG1, κ Isotype Ctrl RTK2071 SB
PE/Fire™ 744 Rat IgG1, κ Isotype Ctrl RTK2071 FC,ICFC
Go To Top Version: 1    Revision Date: 04-20-2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC Rat IgG1, κ Isotype Ctrl

  • Biotin Rat IgG1, κ Isotype Ctrl

  • FITC Rat IgG1, κ Isotype Ctrl

  • PE Rat IgG1, κ Isotype Ctrl

  • PE/Cyanine5 Rat IgG1, κ Isotype Ctrl

  • Purified Rat IgG1, κ Isotype Ctrl

  • PE/Cyanine7 Rat IgG1, κ Isotype Ctrl

  • Alexa Fluor® 647 Rat IgG1, κ Isotype Ctrl

  • Alexa Fluor® 488 Rat IgG1, κ Isotype Ctrl

  • Pacific Blue™ Rat IgG1, κ Isotype Ctrl

  • Alexa Fluor® 700 Rat IgG1, κ Isotype Ctrl

  • APC/Cyanine7 Rat IgG1, κ Isotype Ctrl

  • PerCP Rat IgG1, κ Isotype Ctrl

  • PerCP/Cyanine5.5 Rat IgG1, κ Isotype Ctrl

  • Brilliant Violet 421™ Rat IgG1, κ Isotype Ctrl

  • Ultra-LEAF™ Purified Rat IgG1, κ Isotype Ctrl

  • Brilliant Violet 605™ Rat IgG1, κ Isotype Ctrl

  • Brilliant Violet 510™ Rat IgG1, κ Isotype Ctrl

  • Brilliant Violet 650™ Rat IgG1, κ Isotype Ctrl

  • Brilliant Violet 711™ Rat IgG1, κ Isotype Ctrl

  • Brilliant Violet 785™ Rat IgG1, κ Isotype Ctrl

  • PE/Dazzle™ 594 Rat IgG1, κ Isotype Ctrl

  • Alexa Fluor® 594 Rat IgG1, κ Isotype Ctrl

  • GoInVivo™ Purified Rat IgG1, κ Isotype Ctrl

  • APC/Fire™ 750 Rat IgG1, κ Isotype Ctrl

  • TotalSeq™-A0236 Rat IgG1, κ Isotype Ctrl

  • KIRAVIA Blue 520™ Rat IgG1, κ Isotype Ctrl

  • TotalSeq™-B0236 Rat IgG1, κ Isotype Ctrl

  • TotalSeq™-C0236 Rat IgG1, κ Isotype Ctrl

  • Spark YG™ 581 Rat IgG1, κ Isotype Ctrl

  • Spark YG™ 593 Rat IgG1, κ Isotype Ctrl

  • Spark NIR™ 685 Rat IgG1, κ Isotype Ctrl

  • PE/Fire™ 640 Rat IgG1, κ Isotype Ctrl

  • TotalSeq™-D0236 Rat IgG1, κ Isotype Ctrl

  • PE/Fire™ 700 Rat IgG1, κ Isotype Ctrl

  • APC/Fire™ 810 Rat IgG1, κ Isotype Ctrl

  • Brilliant Violet 750™ Rat IgG1, κ Isotype Ctrl

  • Spark YG™ 570 Rat IgG1, κ Isotype Ctrl

  • PerCP/Fire™ 806 Rat IgG1, κ Isotype Ctrl

  • PerCP/Fire™ 780 Rat IgG1, κ Isotype Ctrl

  • Spark Red™ 718 Rat IgG1, κ Isotype Ctrl

  • TotalSeq™-Bn0236 Rat IgG1, κ Isotype Ctrl

  • PE/Fire™ 744 Rat IgG1, κ Isotype Ctrl

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account