TotalSeq™-D0390 anti-human CD127 (IL-7Rα) Antibody

Pricing & Availability
Clone
A019D5 (See other available formats)
Regulatory Status
RUO
Other Names
IL-7 receptor α chain, IL-7Rα
Isotype
Mouse IgG1, κ
Barcode Sequence
GTGTGTTGTCCTATG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
351371 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD127 is a 60-90 kD type I transmembrane glycoprotein also known as IL-7 receptor α chain or IL-7Rα. It forms a heterodimer with the common γ chain (γc or CD132) which is shared with the receptors for IL-2, IL-4, IL-9, IL-13, IL-15, and IL-21. CD127 is expressed on immature B cells through early pre-B stage cells, thymocytes (except CD4/CD8 double positive thymocytes), peripheral T cells, and bone marrow stromal cells. CD127 has been reported to be a useful marker for identifying memory and effector T cells. Studies have shown that CD127 expression is down-modulated on Treg cells. It can be used as a marker for differentiation of Treg and conventional T cells. The ligation of IL-7 with its receptor is important for stimulation of mature and immature T cells as well as immature B cell proliferation and development.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Recombinant human CD127
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported (for the relevant formats) application: proteogenomics1.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID
AB_2892428 (BioLegend Cat. No. 351371)

Antigen Details

Structure
Type I transmembrane glycoprotein, associates with CD132, 60-90 kD
Distribution

Immature B cells through early pre-B stage, thymocytes (except CD4/CD8 double positive thymocytes), peripheral T cells, bone marrow stromal cells

Function
T cell and immature B cell proliferation and development
Ligand/Receptor
IL-7
Cell Type
B cells, T cells, Thymocytes, Tregs
Biology Area
Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Sudo T, et al. 1993. P. Natl. Acad. Sci. USA 90:9125.
2. He YW and Malek TR. 1998. Crit. Rev. Immunol. 18:503.
3. Huster KM, et al. 2004. P. Natl. Acad. Sci. USA 101:5610.
4. Pillai M, et al. 2004. Leukemia Lymphoma 45:2403.
5. Morrissey PJ, et al. 1989. J. Exp. Med. 169:707.
6. Liu W, et al. 2006. J. Exp. Med. 203:1701.

Gene ID
3575 View all products for this Gene ID
UniProt
View information about CD127 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD127 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD127 (IL-7Rα) A019D5 FC
PE anti-human CD127 (IL-7Rα) A019D5 FC
Pacific Blue™ anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 421™ anti-human CD127 (IL-7Rα) A019D5 FC
FITC anti-human CD127 (IL-7Rα) A019D5 FC
Alexa Fluor® 488 anti-human CD127 (IL-7Rα) A019D5 FC
APC anti-human CD127 (IL-7Rα) A019D5 FC
Alexa Fluor® 647 anti-human CD127 (IL-7Rα) A019D5 FC
PE/Cyanine7 anti-human CD127 (IL-7Rα) A019D5 FC
PerCP/Cyanine5.5 anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 570™ anti-human CD127 (IL-7Rα) A019D5 FC
PE/Cyanine5 anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 650™ anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 711™ anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 785™ anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 510™ anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 605™ anti-human CD127 (IL-7Rα) A019D5 FC
PE/Dazzle™ 594 anti-human CD127 (IL-7Rα) A019D5 FC
Purified anti-human CD127 (IL-7Rα) (Maxpar® Ready) A019D5 FC,CyTOF®
Alexa Fluor® 700 anti-human CD127 (IL-7Rα) A019D5 FC
Biotin anti-human CD127 (IL-7Rα) A019D5 FC
APC/Cyanine7 anti-human CD127 (IL-7Rα) A019D5 FC
APC/Fire™ 750 anti-human CD127 (IL-7Rα) A019D5 FC
TotalSeq™-A0390 anti-human CD127 (IL-7Rα) A019D5 PG
TotalSeq™-B0390 anti-human CD127 (IL-7Rα) A019D5 PG
TotalSeq™-C0390 anti-human CD127 (IL-7Rα) A019D5 PG
KIRAVIA Blue 520™ anti-human CD127 (IL-7Rα) A019D5 FC
Spark NIR™ 685 anti-human CD127 (IL-7Rα) A019D5 FC
PE/Fire™ 640 anti-human CD127 (IL-7Rα) A019D5 FC
PE/Fire™ 700 anti-human CD127 (IL-7Rα) Antibody A019D5 FC
Spark YG™ 581 anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 750™ anti-human CD127 (IL-7Rα) A019D5 FC
TotalSeq™-D0390 anti-human CD127 (IL-7Rα) A019D5 PG
APC/Fire™ 810 anti-human CD127 (IL-7Rα) Antibody A019D5 FC
APC/Fire™ 750 anti-human CD127 A019D5 FC
PE anti-human CD127 A019D5 FC
PerCP/Cyanine5.5 anti-human CD127 A019D5 FC
PE/Cyanine7 anti-human CD127 A019D5 FC
Spark Red™ 718 anti-human CD127 (IL-7Rα) A019D5 FC
GMP PE/Cyanine7 anti-human CD127 (IL-7Rα) A019D5 FC
PE/Fire™ 744 anti-human CD127 (IL-7Rα) A019D5 FC
PerCP/Fire™ 780 anti-human CD127 (IL-7Rα) A019D5 FC
PerCP/Fire™ 806 anti-human CD127 (IL-7Rα) A019D5 FC
Spark PLUS B550™ anti-human CD127 (IL-7Rα) A019D5 FC
GMP PerCP/Cyanine5.5 anti-human CD127 (IL-7Rα) A019D5 FC
GMP PE anti-human CD127 (IL-7Rα) A019D5 FC
GMP APC/Fire™ 750 anti-human CD127 (IL-7Rα) A019D5 FC
Go To Top Version: 1    Revision Date: 05-25-2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account