TotalSeq™-D0391 anti-human CD45 Antibody, CD45, HI30

Pricing & Availability

Clone: HI30 (See other available formats)
Regulatory Status: RUO
Workshop: IV N816
Other Names: LCA, T200
Isotype: Mouse IgG1, κ
Barcode Sequence: TGCAATTACCCGGAT
Ave. Rating: Submit a Review
Product Citations: publications

Compare all formats

Cat #

Size

Price

Quantity Check Availability

Save

304089

10 µg

296€

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

CD45 is a 180-240 kD single chain type I membrane glycoprotein also known as leukocyte common antigen (LCA) and T200. It is a tyrosine phosphatase expressed on the plasma membrane of all hematopoietic cells, except erythrocytes and platelets. CD45 is a signaling molecule that regulates a variety of cellular processes including cell growth, differentiation, cell cycle, and oncogenic transformation. CD45 plays a critical role in T and B cell antigen receptor-mediated activation by dephosphorylating substrates including p56Lck, p59Fyn, and other Src family kinases. CD45 non-covalently associates with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to bind galectin-1 and to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4.

Product Details

Technical Data Sheet (pdf)

Product Details

Verified Reactivity: Human
Reported Reactivity: Chimpanzee
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections and formalin-fixed paraffin-embedded tissue sections⁹, inhibition of CD45 functions⁴, immunofluorescence¹¹, Western blotting³, and spatial biology (IBEX)^16,17.

It was found that the HI30 clone and the 2D1 clone can cross block each other's binding.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2941470 (BioLegend Cat. No. 304089)

Antigen Details

Structure: Tyrosine phosphatases, type I transmembrane protein, 180-240 kD (multiple isoforms)
Distribution: Hematopoietic cells, not expressed in circulating erythrocytes or platelets
Function: TCR and BCR mediated activation
Ligand/Receptor: Galectin-1, CD2, CD3, CD4
Cell Type: Hematopoietic stem and progenitors, Mesenchymal Stem Cells
Biology Area: Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family: CD Molecules
Antigen References: Thomas M. 1989. Annu. Rev. Immunol. 7:339.

Trowbridge I, et al. 1994. Annu. Rev. Immunol.12:85.
Gene ID: 5788 View all products for this Gene ID
UniProt: View information about CD45 on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD45 Reagents Request Custom Conjugation

Description	Clone	Applications
APC anti-human CD45	HI30	FC
Biotin anti-human CD45	HI30	FC
FITC anti-human CD45	HI30	FC
PE anti-human CD45	HI30	FC
PE/Cyanine5 anti-human CD45	HI30	FC
Purified anti-human CD45	HI30	FC,CyTOF®,IHC-P,WB,IHC-F,ICC
APC/Cyanine7 anti-human CD45	HI30	FC
PE/Cyanine7 anti-human CD45	HI30	FC
Alexa Fluor® 488 anti-human CD45	HI30	FC
Alexa Fluor® 647 anti-human CD45	HI30	FC
Pacific Blue™ anti-human CD45	HI30	FC
Alexa Fluor® 700 anti-human CD45	HI30	FC
PerCP anti-human CD45	HI30	FC
PerCP/Cyanine5.5 anti-human CD45	HI30	FC,SB
Brilliant Violet 421™ anti-human CD45	HI30	FC
Brilliant Violet 570™ anti-human CD45	HI30	FC
Brilliant Violet 510™ anti-human CD45	HI30	FC
Brilliant Violet 605™ anti-human CD45	HI30	FC
Brilliant Violet 650™ anti-human CD45	HI30	FC
Purified anti-human CD45 (Maxpar® Ready)	HI30	FC,CyTOF®
Brilliant Violet 785™ anti-human CD45	HI30	FC
Brilliant Violet 711™ anti-human CD45	HI30	FC
PE/Dazzle™ 594 anti-human CD45	HI30	FC
Alexa Fluor® 594 anti-human CD45	HI30	IHC-P,SB
APC/Fire™ 750 anti-human CD45	HI30	FC
Pacific Blue™ anti-human CD45	HI30	FC
APC anti-human CD45	HI30	FC
PE/Cyanine7 anti-human CD45	HI30	FC
PE/Dazzle™ 594 anti-human CD45	HI30	FC
TotalSeq™-A0391 anti-human CD45	HI30	PG
TotalSeq™-B0391 anti-human CD45	HI30	PG
TotalSeq™-C0391 anti-human CD45	HI30	PG
PerCP/Cyanine5.5 anti-human CD45	HI30	FC
APC/Fire™ 750 anti-human CD45	HI30	FC
PE/Fire™ 640 anti-human CD45	HI30	FC
APC/Fire™ 810 anti-human CD45	HI30	FC
Spark YG™ 570 anti-human CD45	HI30	IHC-P
PE/Fire™ 700 anti-human CD45	HI30	FC
FITC anti-human CD45	HI30	FC
PerCP anti-human CD45	HI30	FC
Alexa Fluor® 660 anti-human CD45 Antibody	HI30	FC
Spark Violet™ 538 anti-human CD45	HI30	FC
Spark YG™ 593 anti-human CD45	HI30	FC
GMP APC/Fire™ 750 anti-human CD45	HI30	FC
Spark Violet™ 538 anti-human CD45	HI30	FC
GMP APC anti-human CD45	HI30	FC
Spark UV™ 387 anti-human CD45	HI30	FC
GMP Pacific Blue™ anti-human CD45	HI30	FC
GMP PerCP anti-human CD45	HI30	FC
GMP FITC anti-human CD45	HI30	FC
PE anti-human CD45	HI30	FC
GMP PE/Dazzle™ 594 anti-human CD45	HI30	FC
GMP PerCP/Cyanine5.5 anti-human CD45	HI30	FC
Spark Blue™ 515 anti-human CD45	HI30	FC
TotalSeq™-D0391 anti-human CD45	HI30	PG
GMP PE/Cyanine7 anti-human CD45	HI30	FC
Spark Violet™ 500 anti-human CD45	HI30	FC
GMP PE anti-human CD45	HI30	FC
PE/Fire™ 810 anti-human CD45	HI30	FC
Spark PLUS UV395™ anti-human CD45	HI30	FC
Spark NIR™ 685 anti-human CD45	HI30	FC
Spark Violet™ 423 anti-human CD45	HI30	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 05-17-2023

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.