TotalSeq™-D0447 anti-human CD200 (OX2) Antibody

Pricing & Availability
Clone
OX-104 (See other available formats)
Regulatory Status
RUO
Workshop
VII 70655
Other Names
OX-2, OX2
Isotype
Mouse IgG1, κ
Barcode Sequence
CACGTAGACCTTTGC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
329231 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD200, also known as OX2, is a member of the immunoglobulin superfamily (IgSF). It is a monomorphic cell surface glycoprotein that is expressed on thymocytes, neurons, endothelium, follicular dendritic cells in all lymphoid organs, a subset of CD34+ progenitor cells, and at low levels on some smooth muscle and B lymphocytes. It is not expressed on NK cells, monocytes, granulocytes, or platelets. CD200 costimulates T cell proliferation. It may regulate myeloid cell activity in a variety of tissues. The interaction between CD200 (OX2) and CD200 receptor (OX2R) system is of importance in the control of macrophage and granulocyte activation, which may contribute to pathways that suppress and limit macrophage induced inflammatory damage in tissue.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemistry of formalin-fixed paraffin-embedded sections1 and acetone-fixed frozen sections2, and blocking of CD200 interaction with CD200R.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Patel GK, et al. 2012. J. Invest. Dermatol. 132:401. (IHC)
  2. Wright GJ, et al. 2001. Immunology 102:173. (IHC)
  3. Foster-Cuevas M, et al. 2004. J. Virol. 78:7667. (FC)
RRID
AB_2892395 (BioLegend Cat. No. 329231)

Antigen Details

Structure
Immunoglobulin superfamily
Distribution

T cells, neurons, endothelium

Function
Costimulates T cell proliferation
Receptors
CD200R
Cell Type
Endothelial cells, Neurons, T cells
Biology Area
Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Wright GJ, et al. 2001. Immunol. 102:173.
2. Foster-Cuevas M, et al. 2004. J. Virol. 78:7667.
3. Mason D, et al. 2002. ed. Leukocyte Typing VII. New York:Oxford Univ. Press.
4. Broderick C, et al. 2002. Am. J. Pathol. 161:1669.

Regulation
Induces a downregulation of macrophage activity
Gene ID
4345 View all products for this Gene ID
UniProt
View information about CD200 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05-25-2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account