- Clone
- LN2 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- MHC Class II associated invariant chain, invariant chain, Ii, MHC class II chaperone, MIF receptor
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CTGTAGCATTTCCCT
- Ave. Rating
- Submit a Review
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
326815 | 10 µg | 296€ |
CD74 is a type II transmembrane glycoprotein also known as MHC class II associated invariant chain, invariant chain, Ii, MHC class II chaperone, and MIF receptor. CD74 exists in four isoforms with molecular masses of 33, 35, 41, and 43 kD, depending on genetic splicing. CD74 is primarily expressed on antigen presenting cells, including B cells, monocytes/macrophages, dendritic cells, and Langerhans cells. It is also expressed by activated T cells and activated endothelial and epithelial cells as well as carcinomas of lung, renal, gastric and thymic origin. The primary function of CD74 is intracellular sorting of MHC class II molecules and regulation of exogenous peptide loading onto MHC class II. It is also involved in the modulation of B cell differentiation and positive selection of CD4+ T cells. It has been reported that CD74 binds MIF (macrophage migration inhibitory factor) and signals through CD44 to regulate innate and adaptive immunity. It is also reported that H. pylori infection occurs through urease B binding of CD74 on gastric epithelial cells, inducing gastric epithelial cell apoptosis, NF-κB activation, and IL-8 production.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green, Baboon
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- SU-DHL-4 cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone LN2 is reactive with an epitope residing within 60 amino acids of the extracytoplasmic, COOH terminus of the protein.3
Additional reported applications (for the relevant formats) include: immunohistochemical staining1,2 of frozen sections and formalin-fixed paraffin-embedded sections1,2, immunoprecipitation1, and immunofluorescence4. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Epstein AL, et al.1984. J. Immunol. 133:1028. (IHC, IP)
- Marder RJ, et al. 1985. Lab. Invest. 52:497. (IHC)
- Wraight CJ, et al. 1990. J. Biol. Chem. 265:5787.
- Leng L, et al. 2003. J. Exp. Med. 197:1467. (IF)
- RRID
-
AB_2904347 (BioLegend Cat. No. 326815)
Antigen Details
- Structure
- Type II transmembrane glycoprotein, 33, 35, 41, 43 kD
- Distribution
-
B cells and other antigen presenting cells, activated T cells, activated endothelial and epithelial cells, and certain carcinomas
- Function
- Regulates loading of exogenous peptides onto MHC class II and B cell differentiation, involved in positive selection of CD4+ T cells.
- Ligand/Receptor
- HLA-DR, MIF, H. pylori urease B, associates with CD44
- Cell Type
- Antigen-presenting cells, B cells, Endothelial cells, Epithelial cells, T cells, Tregs
- Biology Area
- Immunology
- Molecular Family
- CD Molecules, MHC Antigens
- Antigen References
-
1. Moldenhauer G, et al. 1999. Immunology 96:473.
2. Shi X, et al. 2006. Immunity 25:595.
3. Beswick EJ, et al. 2006. Infect. Immun. 74:1148.
4. Zola H,et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers Wiley-Liss A John Wiley & Sons Inc, Publication - Gene ID
- 972 View all products for this Gene ID
- UniProt
- View information about CD74 on UniProt.org
Related FAQs
Other Formats
View All CD74 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD74 | LN2 | FC,IHC,IP,ICC |
PE anti-human CD74 | LN2 | FC |
APC anti-human CD74 | LN2 | FC |
TotalSeq™-C0935 anti-human CD74 Antibody | LN2 | PG |
TotalSeq™-D0935 anti-human CD74 | LN2 | PG |
TotalSeq™-B0935 anti-human CD74 | LN2 | PG |
TotalSeq™-A0935 anti-human CD74 | LN2 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD74
Human peripheral blood lymphocytes stained with purified LN2... -
PE anti-human CD74
Human peripheral blood lymphocytes stained with LN2 PE -
APC anti-human CD74
Human peripheral blood lymphocytes were stained with anti-CD... -
TotalSeq™-C0935 anti-human CD74 Antibody
-
TotalSeq™-D0935 anti-human CD74
-
TotalSeq™-B0935 anti-human CD74
-
TotalSeq™-A0935 anti-human CD74
Follow Us