- Clone
- S19005E (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Killer Cell Lectin Like Receptor C2, KLRC2, NK Cell Receptor C
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- ATTCCTGCGCCTAAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
375007 | 10 µg | 296€ |
CD159c, also known as NKG2C or KLRC2, is a type II transmembrane protein. It belongs to the killer cell lectin-like receptor family also known as the NKG2 family. It is expressed on NK and NKT cells and T cell subsets. NKG2C is an activating NK cell receptor and it is expressed as a heterodimer with CD94. In humans, the NKG2C/CD94 complex interacts with HLA-E on target cells and delivers activating signals through immunoreceptor tyrosine-based activation motifs.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human NKG2C/CD94-transfectants
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
S19005E does not crossreact with mouse CD159c.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2936649 (BioLegend Cat. No. 375007)
Antigen Details
- Structure
- Type II transmembrane proteins of the C-type lectin superfamily
- Distribution
-
NK cells, NKT cells, T cell subsets
- Function
- Activating NK cell receptor
- Ligand/Receptor
- HLA-E
- Cell Type
- Lymphocytes, NK cells, NKT cells, T cells
- Biology Area
- Immuno-Oncology, Immunology
- Molecular Family
- Immune Checkpoint Receptors
- Antigen References
-
- Malisheni M, et al. 2017. Front Immunol. 8:863.
- Sáez-Borderías A, et al. 2009. J Immunol, 182:829.
- Kamiya T, et al. 2019. J. Clin. Invest. 129:2094.
- Gene ID
- 3822 View all products for this Gene ID
- UniProt
- View information about CD159c on UniProt.org
Other Formats
View All CD159c (NKG2C) Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD159c (NKG2C) | S19005E | FC |
PE anti-human CD159c (NKG2C) | S19005E | FC |
TotalSeq™-C1375 anti-human CD159c (NKG2C) | S19005E | PG |
TotalSeq™-D1375 anti-human CD159c (NKG2C) | S19005E | PG |
TotalSeq™-B1375 anti-human CD159c (NKG2C) | S19005E | PG |
TotalSeq™-A1375 anti-human CD159c (NKG2C) | S19005E | PG |
Brilliant Violet 421™ anti-human CD159c (NKG2C) | S19005E | FC |
Brilliant Violet 785™ anti-human CD159c (NKG2C) | S19005E | FC |
PE anti-human CD159c | S19005E | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD159c (NKG2C)
-
PE anti-human CD159c (NKG2C)
-
TotalSeq™-C1375 anti-human CD159c (NKG2C)
-
TotalSeq™-D1375 anti-human CD159c (NKG2C)
-
TotalSeq™-B1375 anti-human CD159c (NKG2C)
-
TotalSeq™-A1375 anti-human CD159c (NKG2C)
-
Brilliant Violet 421™ anti-human CD159c (NKG2C)
-
Brilliant Violet 785™ anti-human CD159c (NKG2C)
-
PE anti-human CD159c
Follow Us