- Clone
- HI100 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- IV N906
- Other Names
- GP180, L-CA, LCA, LY5, T200, PTPRC
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- TCAATCCTTCCGCTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
304175 | 10 µg | 296€ |
CD45RA is a 205-220 kD single chain type I glycoprotein. It is an exon 4 splice variant of the tyrosine phosphatase CD45. The CD45RA isoform is expressed on resting/naïve T cells, medullary thymocytes, B cells and monocytes. CD45RA enhances both T cell receptor and B cell receptor signaling. CD45 non-covalently associates with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4. CD45 has also been reported to bind galectin-1. CD45 isoform expression can change in response to cytokines.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Chimpanzee
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for relevant formats of this clone) include: inhibition of CD45 functions2, immunohistochemical staining of frozen tissue sections3 and formalin-fixed paraffin-embedded tissue sections4, and immunocytochemistry15,16.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
- Yamada T, et al. 2002. J. Biol. Chem. 277:28830. (WB, Block)
- Weninger W, et al. 2003 J. Immunol. 170:4638. (IHC-F)
- Imanguli MM, et al. 2009. Blood. 113:3620 (IHC-P)
- Roque S, et al. 2007. J. Immunol. 178:8028. (FC) PubMed
- Smeltz RB. 2007. J. Immunol. 178:4786. (FC) PubMed
- Palendira U, et al. 2008. Blood (FC) PubMed
- Kuttruff S, et al. 2009. Blood 113:358. (FC) PubMed
- Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
- Alanio C, et al. 2010. Blood 115:3718. (FC) PubMed
- Iannello A, et al. 2010. J. Immunol. 184:114. (FC) PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Guereau-de-Arellan M, et al. 2011. Brain. 134:3578. PubMed
- Canque B, et al. 2000. Blood 96:3748. (ICC)
- Imanguli MM, et al. 2009. Blood 13:3620. (ICC)
- Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
- Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
- RRID
-
AB_2892356 (BioLegend Cat. No. 304175)
Antigen Details
- Structure
- Tyrosine phosphatases, type I transmembrane (exon 4 splicing of CD45 gene), 205-220 kD
- Distribution
-
B cells, naïve T cells, monocytes
- Function
- Enhances TCR and BCR signaling
- Ligand/Receptor
- Galectin-1, CD2, CD3, CD4
- Cell Type
- B cells, Monocytes, T cells, Tregs
- Biology Area
- Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers
- Molecular Family
- CD Molecules
- Antigen References
-
1. Thomas M. 1989. Annu. Rev. Immunol. 7:339.
2. Trowbridge I, et al. 1994. Annu. Rev. Immunol.12:85. - Gene ID
- 5788 View all products for this Gene ID
- UniProt
- View information about CD45RA on UniProt.org
Other Formats
View All CD45RA Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD45RA
-
Biotin anti-human CD45RA
-
FITC anti-human CD45RA
-
PE anti-human CD45RA
-
PE/Cyanine5 anti-human CD45RA
-
Purified anti-human CD45RA
-
Alexa Fluor® 488 anti-human CD45RA
-
Alexa Fluor® 647 anti-human CD45RA
-
Pacific Blue™ anti-human CD45RA
-
Alexa Fluor® 700 anti-human CD45RA
-
PerCP/Cyanine5.5 anti-human CD45RA
-
PE/Cyanine7 anti-human CD45RA
-
APC/Cyanine7 anti-human CD45RA
-
Brilliant Violet 421™ anti-human CD45RA
-
Brilliant Violet 570™ anti-human CD45RA
-
Brilliant Violet 605™ anti-human CD45RA
-
Brilliant Violet 650™ anti-human CD45RA
-
Brilliant Violet 711™ anti-human CD45RA
-
Brilliant Violet 785™ anti-human CD45RA
-
Brilliant Violet 510™ anti-human CD45RA
-
Purified anti-human CD45RA (Maxpar® Ready)
-
PE/Dazzle™ 594 anti-human CD45RA
-
APC/Fire™ 750 anti-human CD45RA
-
PerCP anti-human CD45RA
-
FITC anti-human CD45RA
-
TotalSeq™-A0063 anti-human CD45RA
-
Alexa Fluor® 594 anti-human CD45RA
-
TotalSeq™-B0063 anti-human CD45RA
-
TotalSeq™-C0063 anti-human CD45RA
-
Brilliant Violet 750™ anti-human CD45RA
-
Spark NIR™ 685 anti-human CD45RA
-
APC anti-human CD45RA
-
PE/Fire™ 640 anti-human CD45RA
-
PE/Fire™ 700 anti-human CD45RA Antibody
-
Spark YG™ 581 anti-human CD45RA
-
TotalSeq™-D0063 anti-human CD45RA
-
Spark Violet™ 423 anti-human CD45RA
-
GMP FITC anti-human CD45RA
-
PE/Cyanine7 anti-human CD45RA
-
PE/Dazzle™ 594 anti-human CD45RA
-
APC/Fire™ 750 anti-human CD45RA
-
Spark UV™ 387 anti-human CD45RA
-
GMP APC anti-human CD45RA
-
TotalSeq™-Bn0063 anti-human CD45RA
-
Spark Blue™ 550 anti-human CD45RA
-
GMP PE/Dazzle™ 594 anti-human CD45RA
-
GMP APC/Fire™ 750 anti-human CD45RA
-
Spark PLUS UV™ 395 anti-human CD45RA
-
Spark Red™ 718 anti-human CD45RA
-
PE/Fire™ 810 anti-human CD45RA
Follow Us