TotalSeq™-D0161 anti-human CD11b Antibody

Pricing & Availability
Clone
ICRF44 (See other available formats)
Regulatory Status
RUO
Workshop
IV M047
Other Names
Integrin αM chain, C3biR, CR3, Mac-1, Mo1, ITGAM
Isotype
Mouse IgG1, κ
Barcode Sequence
GACAAGTGATCTGCA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
301363 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD11b is a 165-170 kD type I transmembrane glycoprotein also known as αM integrin, Mac-1, CR3, and C3biR. CD11b non-covalently associates with integrin β2 (CD18) and is expressed on granulocytes, monocytes/macrophages, dendritic cells, NK cells, and subsets of T and B cells. CD11b/CD18 is critical for the transendothelial migration of monocytes and neutrophils. It is also involved in granulocyte adhesion, phagocytosis, and neutrophil activation. CD11b/CD18 interacts with ICAM-1 (CD54), ICAM-2 (CD102), ICAM-4, CD14, CD23, heparin, iC3b, fibrinogen, and factor X.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Chimpanzee, Common Marmoset, Pig
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The ICRF44 antibody inhibits heterotypic adhesion of granulocytes in response to fMLP. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections, immunofluorescence microscopy5, stimulation of monocytes3, blocking of heterotypic PMN aggregation8, and blocking of granulocyte activation12. This clone was tested in-house and does not work on formalin fixed paraffin-embedded (FFPE) tissue.

The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 301361 & 301362).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W. 1989. Leucocyte Typing IV. Oxford University Press New York.
  2. Barclay N, et al. 1997. The Leucocyte Antigen Facts Book. Academic Press Inc. San Diego.
  3. Rezzonico R, et al. 2001. Blood 97:2932. (Stim)
  4. Marsik C, et al. 2003. Shock 20:493. (FC)
  5. David A, et al. 2003. J. Leukoc. Biol. 74:551. (IF)
  6. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  7. Thurlow LR, et al. 2010. Infect. Immun. 128:1128. (FC) PubMed
  8. Jadhav S, et al. 2001. J. Immunol. 167:5986. (Block)
  9. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  10. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21. (FC)
  11. Wen T, et al. 2014. J Immunol. 192:5481. (FC) PubMed
  12. Sprong T, et al. 2003. Blood 102:3702. (Block)
  13. Cash JL, et al. 2013. EMBO Rep. 14:999. (FC) PubMed
  14. Larsson K, et al. 2015. PNAS. PubMed
RRID
AB_2892345 (BioLegend Cat. No. 301363)

Antigen Details

Structure
Integrin, type I transmembrane glycoprotein, associates with integrin β2 (CD18), 165-170 kD
Distribution

Granulocytes, monocytes/macrophages, dendritic cells, NK cells, subset of T cells, subset of B cells

Function
Adhesion, phagocytosis, chemotaxis, neutrophil activation
Ligand/Receptor
ICAM-1(CD54), ICAM-2 (CD102), ICAM-4, CD14, CD23, heparin, iC3b, fibrinogen, factor X
Cell Type
B cells, Dendritic cells, Granulocytes, Macrophages, Monocytes, Neutrophils, NK cells, T cells, Tregs
Biology Area
Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity, Neuroscience, Neuroscience Cell Markers
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Stewart M, et al. 1995. Curr Opin Cell Biol. 7:690.

Gene ID
3684 View all products for this Gene ID
UniProt
View information about CD11b on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD11b Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD11b ICRF44 FC
Biotin anti-human CD11b ICRF44 FC
PE anti-human CD11b ICRF44 FC
PE/Cyanine5 anti-human CD11b ICRF44 FC
Purified anti-human CD11b ICRF44 FC,CyTOF®,ICC,IHC
Pacific Blue™ anti-human CD11b ICRF44 FC
Alexa Fluor® 488 anti-human CD11b ICRF44 FC
Alexa Fluor® 647 anti-human CD11b ICRF44 FC
PE/Cyanine7 anti-human CD11b ICRF44 FC
PerCP/Cyanine5.5 anti-human CD11b ICRF44 FC
Brilliant Violet 421™ anti-human CD11b ICRF44 FC,ICC
Brilliant Violet 570™ anti-human CD11b ICRF44 FC
FITC anti-human CD11b ICRF44 FC
Brilliant Violet 605™ anti-human CD11b ICRF44 FC
Brilliant Violet 510™ anti-human CD11b ICRF44 FC,ICC
Brilliant Violet 650™ anti-human CD11b ICRF44 FC
Purified anti-human CD11b (Maxpar® Ready) ICRF44 FC,CyTOF®
Alexa Fluor® 594 anti-human CD11b ICRF44 ICC,FC
APC/Cyanine7 anti-human CD11b ICRF44 FC
Brilliant Violet 711™ anti-human CD11b ICRF44 FC
Brilliant Violet 785™ anti-human CD11b ICRF44 FC
PE/Dazzle™ 594 anti-human CD11b ICRF44 FC
APC/Fire™ 750 anti-human CD11b ICRF44 FC
APC anti-human CD11b ICRF44 FC
PE anti-human CD11b ICRF44 FC
TotalSeq™-A0161 anti-human CD11b ICRF44 PG
Alexa Fluor® 700 anti-human CD11b ICRF44 FC
PE/Cyanine7 anti-human CD11b ICRF44 FC
TotalSeq™-B0161 anti-human CD11b ICRF44 PG
TotalSeq™-C0161 anti-human CD11b ICRF44 PG
PerCP/Cyanine5.5 anti-human CD11b ICRF44 FC
Ultra-LEAF™ Purified anti-human CD11b ICRF44 FC,CyTOF®,Block,ICC,IHC
TotalSeq™-D0161 anti-human CD11b ICRF44 PG
GMP PE/Cyanine7 anti-human CD11b ICRF44 FC
Pacific Blue™ anti-human CD11b ICRF44 FC
GMP PE anti-human CD11b ICRF44 FC
Spark UV™ 387 anti-human CD11b ICRF44 FC
GMP PerCP/Cyanine5.5 anti-human CD11b ICRF44 FC
FITC anti-human CD11b ICRF44 FC
APC/Fire™ 750 anti-human CD11b ICRF44 FC
GMP APC anti-human CD11b ICRF44 FC
GMP FITC anti-human CD11b ICRF44 FC
GMP APC/Fire™ 750 anti-human CD11b ICRF44 FC
Spark Blue™ 515 anti-human CD11b ICRF44 FC
Spark Violet™ 500 anti-human CD11b ICRF44 FC
Spark Red™ 718 anti-human CD11b (Flexi-Fluor™) ICRF44 FC
Go To Top Version: 1    Revision Date: 05.20.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account