TotalSeq™-D0185 anti-human CD11a Antibody

Product Details

Verified Reactivity

Human

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

HLA-DR CTL line

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Application Notes

Additional reported applications (for relevant formats) include: immunoprecipitation^{1, 2}. Note: the antibody TS2/4 recognizes the ß-propeller domain of CD11a and only immunoprecipitates the CD11a/CD18 complex.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)

1. Huang C and Springer TA. 1997. P. Natl. Acad. Sci. USA 94:3162. (IP)
2. Sanchez-Madrid F, et al. 1983. J. Exp. Med. 158:1785. (IP)
3. Sanchez-Madrid F, et al. 1982. P. Natl. Acad. Sci. USA 79:7489. (FC)

RRID

AB_2892426 (BioLegend Cat. No. 350621)

Antigen Details

Structure

Integrin, type I transmembrane glycoprotein, noncovalently linked with integrin β₂ (CD18) forms LFA-1, 170-180 kD

Distribution

Leukocytes

Function

Adhesion, costimulation

Ligand/Receptor

ICAM-1(CD54), ICAM-2(CD102), ICAM-3(CD50)

Cell Type

Leukocytes, Tregs

Biology Area

Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity, Neuroinflammation, Neuroscience

Molecular Family

Adhesion Molecules, CD Molecules

Antigen References

1. Lub M, et al. 1995. Immunol. Today 16:479.
2. Parsons J. 1996. Curr. Opin. Cell Biol. 8:146.

Gene ID

3683 View all products for this Gene ID

UniProt

View information about CD11a on UniProt.org

Documentation

• Technical data sheet
• Certificate of Analysis
• Safety Data Sheet

Reviews

Related Protocols

• TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Pages & Pathways

Related FAQs

Other Formats

Certificate of Analysis