TotalSeq™-D0576 anti-human CD49d Antibody

Pricing & Availability
Clone
9F10 (See other available formats)
Regulatory Status
RUO
Workshop
V S215
Other Names
VLA-4 α chain, α4 integrin, Integrin α4 chain, ITGA4
Isotype
Mouse IgG1, κ
Barcode Sequence
CCATTCAACTTCCGG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
304349 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD49d is a 150 kD α integrin chain known as α4 integrin or VLA-4 α chain. It forms a heterodimer with either integrin β1 (α4β1, VLA-4) or β7 (α4β7). CD49d is expressed broadly on T lymphocytes, B lymphocytes, monocytes, thymocytes, eosinophils, basophils, mast cells, NK cells, dendritic cells, and some non-hematopoietic cells, but not on normal red blood cells, platelets or neutrophils. VLA-4 binds to VCAM-1 (CD106) and fibronectin. α4β7 is the receptor for VCAM-1 and MAdCAM-1. CD49d participates in mononuclear cell trafficking to endothelial sites of inflammation and has roles in cell-cell interactions and cell adhesion to extracellular matrices. CD49d is involved in lymphocyte migration, T cell activation, and hematopoietic stem cell differentiation. CD49d is a marker to isolate pure populations of Treg cells due to its absence on Foxp3+ cells.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Cat, Cow, Chimpanzee, Common Marmoset, Dog, Horse, Sheep, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections, and in vitro T cell costimulation2,3. The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 304339 and 304340).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Jeong SH, et al. 2004. J. Virol. 78:6995. (Costim)
  3. Vogel TU, et al. 2002. J. Immunol. 169:4511. (Costim)
  4. Kleinewietfeld M, et al. 2009. Blood 113:827. (FC) PubMed
  5. Palacious F, et al. 2010. Blood 115:4488. PubMed
  6. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  7. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
  8. Mattapallil MJ, et al. 2011. J. Immunol. 187:1977. PubMed
RRID
AB_2892357 (BioLegend Cat. No. 304349)

Antigen Details

Structure
Integrin, type I transmembrane glycoprotein, 150 kD.
Distribution

T cells, B cells, NK , dendritic cells, thymocytes, monocytes, eosinophils, mast cells.

Function
Lymphocyte migration, T cell activation, stem cell differentiation.
Ligand/Receptor
Fibronectin, VCAM-1, MAdCAM-1
Cell Type
B cells, Dendritic cells, Eosinophils, Mast cells, Monocytes, NK cells, T cells, Thymocytes, Tregs
Biology Area
Cell Adhesion, Cell Biology, Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Elices M, Ed.1995. Springer Semin. Immunopathol. 16(4).
2. Lobb RR and Helmer ME. et al. 1994. J. Clin. Invest. 94:1722.

Gene ID
3676 View all products for this Gene ID
UniProt
View information about CD49d on UniProt.org
Go To Top Version: 1    Revision Date: 05.24.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account