TotalSeq™-D0050 anti-human CD19 Antibody

Pricing & Availability
Clone
HIB19 (See other available formats)
Regulatory Status
RUO
Workshop
V CD19.11
Other Names
B4
Isotype
Mouse IgG1, κ
Barcode Sequence
CTGGGCAATTACTCG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
302277 10 µg £253
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD19 is a 95 kD type I transmembrane glycoprotein also known as B4. It is a member of the immunoglobulin superfamily expressed on B-cells (from pro-B to blastoid B cells, absent on plasma cells) and follicular dendritic cells. CD19 is involved in B cell development, activation, and differentiation. CD19 forms a complex with CD21 (CR2) and CD81 (TAPA-1), and functions as a BCR co-receptor.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections8 and blocking of B cell proliferation. Clone HIB19 is not recommended for formalin-fixed paraffin-embedded sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 302267 & 302268).

 

Clone HIB19 partially blocks anti-human CD19 clones 4G7 and SJ25C1 staining based on in-house testing

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. 1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
  3. Bradbury L, et al. 1993. J. Immunol. 151:2915.
  4. Joseph A, et al. 2010. J. Virol. 84:6645. PubMed
  5. Wang X, et al. 2010. Haematologica. 95:884. (FC) PubMed
  6. Walker JD, et al. 2009. J. Immunol. 182:1548. (Block) PubMed
  7. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  8. Hansen A, et al. 2002. Arthritis Rheum. 46:2160. (IHC)
  9. Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
  10. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID
AB_2892349 (BioLegend Cat. No. 302277)

Antigen Details

Structure
Ig superfamily, type I transmembrane glycoprotein, 95 kD
Distribution

B lineage (except plasma cells), follicular dendritic cells

Function
B cell activation and differentiation
Ligand/Receptor
Forms complex with CD21 (CR2) and CD81 (TAPA-1), BCR coreceptor
Cell Type
B cells, Dendritic cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Tedder T, et al. 1994. Immunol. Today 15:437.
2. Bradbury L, et al. 1993. J. Immunol. 151:2915.

Gene ID
930 View all products for this Gene ID
UniProt
View information about CD19 on UniProt.org

Other Formats

View All CD19 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD19 HIB19 FC
Biotin anti-human CD19 HIB19 FC
FITC anti-human CD19 HIB19 FC
PE anti-human CD19 HIB19 FC
PE/Cyanine5 anti-human CD19 HIB19 FC
Purified anti-human CD19 HIB19 FC,CyTOF®,IHC-F
APC/Cyanine7 anti-human CD19 HIB19 FC
PE/Cyanine7 anti-human CD19 HIB19 FC
Alexa Fluor® 488 anti-human CD19 HIB19 FC,ICC
Alexa Fluor® 647 anti-human CD19 HIB19 FC,IHC-F
Pacific Blue™ anti-human CD19 HIB19 FC
Alexa Fluor® 700 anti-human CD19 HIB19 FC
PerCP anti-human CD19 HIB19 FC
PerCP/Cyanine5.5 anti-human CD19 HIB19 FC
Brilliant Violet 421™ anti-human CD19 HIB19 FC,ICC,IHC-F
Brilliant Violet 570™ anti-human CD19 HIB19 FC
Brilliant Violet 650™ anti-human CD19 HIB19 FC
Brilliant Violet 785™ anti-human CD19 HIB19 FC
Brilliant Violet 510™ anti-human CD19 HIB19 FC
Brilliant Violet 605™ anti-human CD19 HIB19 FC
Brilliant Violet 711™ anti-human CD19 HIB19 FC
Purified anti-human CD19 (Maxpar® Ready) HIB19 FC,CyTOF®
Alexa Fluor® 594 anti-human CD19 HIB19 ICC,IHC-F
PE/Dazzle™ 594 anti-human CD19 HIB19 FC
PE anti-human CD19 HIB19 FC
APC/Fire™ 750 anti-human CD19 HIB19 FC
Pacific Blue™ anti-human CD19 HIB19 FC
APC anti-human CD19 HIB19 FC
PE/Cyanine7 anti-human CD19 HIB19 FC
TotalSeq™-A0050 anti-human CD19 HIB19 PG
Brilliant Violet 750™ anti-human CD19 HIB19 FC
TotalSeq™-B0050 anti-human CD19 HIB19 PG
TotalSeq™-C0050 anti-human CD19 HIB19 PG
PerCP/Cyanine5.5 anti-human CD19 HIB19 FC
Spark NIR™ 685 anti-human CD19 HIB19 FC
Ultra-LEAF™ Purified anti-human CD19 HIB19 FC,CyTOF®,Block,IHC
APC/Fire™ 810 anti-human CD19 HIB19 FC
PE/Fire™ 640 anti-human CD19 HIB19 FC
PE/Fire™ 700 anti-human CD19 HIB19 FC
TotalSeq™-D0050 anti-human CD19 HIB19 PG
Spark YG™ 593 anti-human CD19 HIB19 FC
GMP Pacific Blue™ anti-human CD19 HIB19 FC
Spark Violet™ 423 anti-human CD19 HIB19 FC
GMP PE anti-human CD19 HIB19 FC
GMP APC anti-human CD19 HIB19 FC
KIRAVIA Blue 520™ anti-human CD19 HIB19 FC
GMP PerCP/Cyanine5.5 anti-human CD19 HIB19 FC
GMP PE/Cyanine7 anti-human CD19 HIB19 FC
Spark Violet™ 500 anti-human CD19 HIB19 FC
PE/Fire™ 810 anti-human CD19 HIB19 FC
Spark Violet™ 423 anti-human CD19 HIB19 FC
Spark UV™ 387 anti-human CD19 HIB19 FC
APC/Fire™ 750 anti-human CD19 HIB19 FC
PE/Cyanine5 anti-human CD19 HIB19 FC
Alexa Fluor® 660 anti-human CD19 HIB19 FC
PerCP/Fire™ 806 anti-human CD19 HIB19 FC
PerCP/Fire™ 780 anti-human CD19 HIB19 FC
Spark PLUS UV395™ anti-human CD19 HIB19 FC
Spark Red™ 718 anti-human CD19 HIB19 FC
FITC anti-human CD19 HIB19 FC
Go To Top Version: 1    Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account