Loading...

TotalSeq™-D0053 anti-human CD11c Antibody

Pricing & Availability
Clone
S-HCL-3 (See other available formats)
Regulatory Status
RUO
Other Names
Integrin αX subunit, CR4, p150, ITGAX
Isotype
Mouse IgG2b, κ
Barcode Sequence
TACGCCTATAACTTG
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
371527 10 µg £253
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD11c is a 145-150 kD type I transmembrane glycoprotein also known as integrin αx and CR4. CD11c non-covalently associates with integrin β2 (CD18) and is expressed on monocytes/macrophages, dendritic cells, granulocytes, NK cells, and subsets of T and B cells. CD11c has been reported to play a role in adhesion and CTL killing through its interactions with fibrinogen, CD54, and iC3b.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Spleen cells from patient diagnosed with hairy cell leukemia.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemistry on frozen tissue sections1,2,3,4 and immunoprecipitation1.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna.

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schwarting R, et al. 1985. Blood 65:974.
  2. Knowles DM, et al. 1990. Am. J. Pathol. 136:29.
  3. Vandenabeele S, et al. 2001. Blood 97:1733.
  4. Shaw JL, et al. 2011. J. Reprod. Immunol. 89:84.
RRID
AB_2894601 (BioLegend Cat. No. 371527)

Antigen Details

Structure
Integrin, type I transmembrane glycoprotein, associates with integrin ß2 (CD18), 145-150 kD.
Distribution

Myeloid, dendritic cells, NK cells, B cells and T cell subsets.

Function
Adhesion and CTL killing.
Interaction
Interacts with fibrinogen, CD54, and iC3b.
Ligand/Receptor
CD54, fibrinogen, iC3b, ICAM-1, ICAM-4
Cell Type
B cells, Dendritic cells, NK cells, T cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Petty HR, Todd RF 3rd. 1996. Immunol. Today 17:209.
2. Springer T. 1994. Cell 76:301.
3. Ihanus E, et al. 2007. Blood 109:802-10.

Gene ID
3687 View all products for this Gene ID
UniProt
View information about CD11c on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 09/02/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account