Login / Register 
United States ($) USD
Austria (€) EUR
Belgium (€) EUR
Finland (€) EUR
France (€) EUR
Germany (€) EUR
Ireland (€) EUR
Japan (¥) JPY
Luxembourg (€) EUR
Netherlands (€) EUR
Switzerland (CHF) CHF
United Kingdom (£) GBP
- Clone
- DX2 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VI C-64
- Other Names
- Fas, APO-1, TNFRSF6
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CCAGCTCATTAGAGC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Check Availability | Save | ||
|---|---|---|---|---|---|---|
| 305659 | 10 µg | £253 | ||||
CD95 is a 45 kD single chain type I glycoprotein also known as Fas, APO-1, and TNFRSF6. It is a member of the TNF receptor superfamily. CD95 is expressed on T and B lymphocytes, monocytes, neutrophils, and fibroblasts. CD95 expression is upregulated by activation. The extracellular region of CD95 binds to CD178 (Fas ligand). CD178 binding to CD95 induces apoptosis and has been shown to play a role in the maintenance of peripheral tolerance.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green, Baboon, Capuchin Monkey, Chimpanzee, Common Marmoset, Cotton-topped Tamarin, Pigtailed Macaque, Sooty Mangabey
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- CD95 transfected L cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The DX2 antibody is useful for inducing apoptosis of Fas-positive cells. Additional reported applications (for the relevant formats) include: in vitro induction of apoptosis3 (DX2 antibody is required to be cross-linked for effective induction of apoptosis) and immunohistochemical staining4,5 of acetone-fixed frozen tissue sections and formalin-fixed paraffin-embedded tissue sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 305655 and 305656).
Note: EOS9.1 antibody can induce apoptosis without cross-linking. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Schlossman S, et al. Eds.1995. Leucocyte Typing V. Oxford University Press. New York.
- Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. New York.
- Cifone M, et al. 1994. J. Exp. Med. 180:1547. (Apop)
- Zietz C, et al. 2001. Am. J. Pathol. 159:963. (IHC)
- Sergi C, et al. 2000. Am. J. Pathol. 156:1589. (IHC)
- Xie S, et al. 2010. J. Immunol. 184:2289. (FC) PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
- Rout N, et al. 2010. PLoS One 5:e9787. (FC)
- Dixit N, et al. 2012. J. Immunol. 189:5954. PubMed
- RRID
-
AB_2892366 (BioLegend Cat. No. 305659)
Antigen Details
- Structure
- TNFR superfamily, type I transmembrane protein, 45 kD
- Distribution
-
T cells and B cells, monocytes, neutrophils, fibroblasts, expression level upregulated on activated lymphocytes
- Function
- Mediates apoptosis
- Ligand/Receptor
- Fas ligand (CD178)
- Cell Type
- B cells, Fibroblasts, Lymphocytes, Monocytes, Neutrophils, T cells
- Biology Area
- Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology, Neuroscience
- Molecular Family
- CD Molecules
- Antigen References
-
1. Krammer P, et al. 1994. Immunol. Rev. 142:175.
2. Nagata S, et al. 1995. Science 267:1449. - Gene ID
- 355 View all products for this Gene ID
- UniProt
- View information about CD95 on UniProt.org
Related Pages & Pathways
Pathways
Related FAQs
Other Formats
View All CD95 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD95 (Fas)
Human peripheral blood lymphocytes stained with DX2 APC -
Biotin anti-human CD95 (Fas)
Human peripheral blood lymphocytes stained with biotinylated... -
FITC anti-human CD95 (Fas)
Human peripheral blood lymphocytes stained with DX2 FITC -
PE anti-human CD95 (Fas)
Human peripheral blood lymphocytes stained with DX2 PE -
PE/Cyanine5 anti-human CD95 (Fas)
Human peripheral blood lymphocytes stained with DX2 PE/Cyani... -
Purified anti-human CD95 (Fas)
Human peripheral blood lymphocytes stainedwith DX2 PE/Cyanin... 
MCF7 breast cancer cells were stained with anti-human CD95 (... -
Alexa Fluor® 488 anti-human CD95 (Fas)
Human peripheral blood lymphocytes stained with DX2 Alexa Fl... -
Alexa Fluor® 647 anti-human CD95 (Fas)
Human peripheral blood lymphocytes stained with DX2 Alexa Fl... -
Brilliant Violet 421™ anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (c... -
Pacific Blue™ anti-human CD95 (Fas)
Human peripheral blood lymphocytes stained with DX2 Pacific ... -
PE/Cyanine7 anti-human CD95 (Fas)
Human peripheral blood lymphocytes stained with DX2 PE/Cyani... -
Brilliant Violet 605™ anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (c... -
PerCP/Cyanine5.5 anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (c... -
Purified anti-human CD95 (Fas) (Maxpar® Ready)
Human PBMCs stained with 154Sm-anti-CD45 (HI30) and 164Dγ-an... -
PE/Dazzle™ 594 anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (c... -
APC/Fire™ 750 anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (c... -
APC/Cyanine7 anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (F... -
Brilliant Violet 510™ anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (c... -
Brilliant Violet 711™ anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (c... -
Brilliant Violet 785™ anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (c... -
Brilliant Violet 650™ anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (c... -
Alexa Fluor® 700 anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with CD95 (F... -
TotalSeq™-A0156 anti-human CD95 (Fas)
-
TotalSeq™-C0156 anti-human CD95 (Fas)
-
TotalSeq™-B0156 anti-human CD95 (Fas)
-
Ultra-LEAF™ Purified anti-human CD95 (Fas)
Human peripheral blood lymphocytes stained with Ultra-LEAF™ ...
MCF7 breast cancer cells were stained with anti-human CD95 (... -
TotalSeq™-D0156 anti-human CD95 (Fas)
-
PE/Fire™ 640 anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with anti-hu... -
KIRAVIA Blue 520™ anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with anti-hu... -
APC/Fire™ 810 anti-human CD95 (Fas) Antibody
Human peripheral lymphocytes were stained with anti-human CD... -
PE anti-human CD95
Typical results from human peripheral blood lymphocytes stai... -
Spark YG™ 593 anti-human CD95 (Fas)
Human peripheral blood monocytes were stained with anti-huma... 
Human peripheral blood monocytes were stained with anti-huma... -
PE/Fire™ 700 anti-human CD95 (Fas)
Human peripheral blood monocytes were stained with anti-huma... 
Human peripheral blood monocytes were stained with anti-huma... -
PerCP/Fire™ 780 anti-human CD95 (Fas)
Human peripheral blood monocytes were stained with anti-huma... 
Human peripheral blood monocytes were stained with anti-huma... -
Spark Blue™ 574 anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Red™ 718 anti-human CD95 (Fas)
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP PE anti-human CD95 (Fas)
Typical results from human peripheral blood lymphocytes stai...
Follow Us