- Clone
- QA17A04 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- HNK-1, NK-1, Leu-7, B3GAT1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AACTCCCTATGGAGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
393333 | 10 µg | £253 |
CD57, also known as HNK-1, NK-1, and Leu-7 is a 100-115 kD oligosaccharide antigenic determinant expressed on a variety of proteins, lipids, and chondroitin sulfate proteoglycans. CD57 is expressed on a subset of peripheral blood lymphocytes, including NK cells and CD8+ T cells, and is also expressed on neural cells and striated muscle. CD57 is not expressed on red blood cells, granulocytes, monocytes, or platelets. While the function of CD57 is unknown, binding to L-selectin, P-selectin, and a fragment of laminin suggests that CD57 may be involved in cell-matrix interactions. CD57 is increased in some disease states associated with CD4/CD8 imbalances (AIDS, autoimmune disease, viral infections, and allograft transplants).
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Recombinant
- Host Species
- Mouse
- Immunogen
- Membrane extract of human lymphoblastoid cell line HSB-2.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2894666 (BioLegend Cat. No. 393333)
Antigen Details
- Structure
- Oligosaccharide antigenic determinant present on a variety of proteins, lipds, and chrondroitin sulfate proteoglycans, 100-115 kD. The antigen is convserved across species.
- Distribution
-
NK cells, subset of CD8+ T cells, neural cells, striated muscle
- Ligand/Receptor
- Binds to L-selectin and P-selectin in a calcium-dependent manner, also binds to second globular domain of E8 laminin fragment.
- Cell Type
- NK cells, T cells
- Biology Area
- Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
- Schubert J, et al. 1989. In Leucocyte Typing IV (Knapp W, ed) Oxford University Press Oxford pp 711-714.
- Palmer BE, et al. 2005. J. Immunol. 175:8415.
- Schachner M, et al. 1995. Trends Neurosci. 18:183.
- Wood KL, et al. 2005. Clin. Immunol. 117:294.
- Gene ID
- 27087 View all products for this Gene ID
- UniProt
- View information about CD57 on UniProt.org
Other Formats
View All CD57 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with purifed... IHC staining using purified anti-CD57 antibody (clone QA17A0... -
Brilliant Violet 605™ anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD56 AP... -
APC anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD56 PE... -
Brilliant Violet 510™ anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD8 APC... -
PerCP/Cyanine5.5 anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD8 APC... -
PE anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD8 APC... -
PE/Cyanine7 anti-human CD57 Recombinant Antibody
Human TruStain FcX™ (Cat. No. 422302) treated human peripher... -
PE/Dazzle™ 594 anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with True-St... Human peripheral blood lymphocytes were stained with True-St... -
TotalSeq™-C0168 anti-human CD57 Recombinant Antibody
-
TotalSeq™-A0168 anti-human CD57 Recombinant Antibody
-
TotalSeq™-B0168 anti-human CD57 Recombinant Antibody
-
Brilliant Violet 785™ anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD56 AP... Human peripheral blood lymphocytes were stained with CD8 Ale... -
Brilliant Violet 421™ anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD8 Ale... Human peripheral blood lymphocytes were stained with CD56 AP... -
Brilliant Violet 711™ anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with CD56 AP... Human peripheral blood lymphocytes were stained with CD8 Ale... -
TotalSeq™-D0168 anti-human CD57 Recombinant Antibody
-
Spark PLUS UV395™ anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with anti-hu... Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 780 anti-human CD57 Recombinant Antibody
Human peripheral blood lymphocytes were stained with anti-hu...
Follow Us