- Clone
- TS2/9 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Lymphocyte function-associated antigen 3, LFA-3
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GTTCCTATGGACGAC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
330929 | 10 µg | £253 |
CD58, also known as lymphocyte function-associated antigen 3 (LFA-3) is a 45-70 kD cell surface protein that is a member of the immunoglobulin superfamily. Alternative splicing of CD58 gives rise to transmembrane and glycosylphosphatidylinositol (GPI)-anchored forms on cell surface. CD58 is expressed on both hematopoietic and non-hematopoietic cells including B cells, T cells, monocytes, erythrocytes, endothelial cells, epithelial cells, and fibroblasts. High levels are observed on memory T cells and dendritic cells. CD58 expressed on antigen presenting cells and target cells enhances T cell recognition via the binding of it's cognate ligand, CD2, on the T cell surface.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human cytolytic T cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications include: immunoprecipitation1, inhibition of cytolytic activity1, augment of IL-1 release by TE cells2
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Sanchez-Madrid F, et al. 1982. Proc. Nati Acad. Sci. USA. 79:7489
- Le PT, et al. 1990. J. Immunol. 144:4541
- RRID
-
AB_2910395 (BioLegend Cat. No. 330929)
Antigen Details
- Structure
- Immunoglobulin superfamily member, 45-70 kD cell surface protein. Alternative splicing gives rise to transmembrane and glycosylphosphatidylinositol (GPI)-anchored form on cell surface.
- Distribution
-
Expressed on both hematopoietic and non-hematopoietic cells including B cells, T cells, monocytes, erythrocytes, endothelial cells, epithelial cells, and fibroblasts. High levels are observed on memory T cells and dendritic cells.
- Function
- Mediates adhesion between various cell types (target cells and cytotoxic cells, APC and T cells, thymocytes and thymic epithelia).
- Ligand/Receptor
- CD2
- Cell Type
- B cells, Dendritic cells
- Biology Area
- Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Springer TA, et al. 1987. Annu. Rev. Immunol. 5:223.
2. Dustin ML, et al. 1987. Nature 329:846.
3. Arulanandam AR, et al. 1994. J. Exp. Med. 180:1861.
4. Sanders ME, et al. 1988. J. Immunol. 140:1401. - Gene ID
- 965 View all products for this Gene ID
- UniProt
- View information about CD58 on UniProt.org
Other Formats
View All CD58 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD58 (LFA-3) | TS2/9 | FC,IP |
PE anti-human CD58 (LFA-3) | TS2/9 | FC |
PE/Cyanine5 anti-human CD58 | TS2/9 | FC |
PerCP/Cyanine5.5 anti-human CD58 (LFA-3) | TS2/9 | FC |
PE/Cyanine7 anti-human CD58 (LFA-3) | TS2/9 | FC |
APC anti-human CD58 (LFA-3) | TS2/9 | FC |
TotalSeq™-A0174 anti-human CD58 (LFA-3) | TS2/9 | PG |
TotalSeq™-C0174 anti-human CD58 (LFA-3) | TS2/9 | PG |
Ultra-LEAF™ Purified anti-human CD58 (LFA-3) | TS2/9 | FC,IP,IHC,Block |
TotalSeq™-B0174 anti-human CD58 (LFA-3) | TS2/9 | PG |
TotalSeq™-D0174 anti-human CD58 (LFA-3) | TS2/9 | PG |
PE anti-human CD58 | TS2/9 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD58 (LFA-3)
-
PE anti-human CD58 (LFA-3)
-
PE/Cyanine5 anti-human CD58
-
PerCP/Cyanine5.5 anti-human CD58 (LFA-3)
-
PE/Cyanine7 anti-human CD58 (LFA-3)
-
APC anti-human CD58 (LFA-3)
-
TotalSeq™-A0174 anti-human CD58 (LFA-3)
-
TotalSeq™-C0174 anti-human CD58 (LFA-3)
-
Ultra-LEAF™ Purified anti-human CD58 (LFA-3)
-
TotalSeq™-B0174 anti-human CD58 (LFA-3)
-
TotalSeq™-D0174 anti-human CD58 (LFA-3)
-
PE anti-human CD58
Follow Us