- Clone
- 9F10 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V S215
- Other Names
- VLA-4 α chain, α4 integrin, Integrin α4 chain, ITGA4
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CCATTCAACTTCCGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
304349 | 10 µg | £253 |
CD49d is a 150 kD α integrin chain known as α4 integrin or VLA-4 α chain. It forms a heterodimer with either integrin β1 (α4β1, VLA-4) or β7 (α4β7). CD49d is expressed broadly on T lymphocytes, B lymphocytes, monocytes, thymocytes, eosinophils, basophils, mast cells, NK cells, dendritic cells, and some non-hematopoietic cells, but not on normal red blood cells, platelets or neutrophils. VLA-4 binds to VCAM-1 (CD106) and fibronectin. α4β7 is the receptor for VCAM-1 and MAdCAM-1. CD49d participates in mononuclear cell trafficking to endothelial sites of inflammation and has roles in cell-cell interactions and cell adhesion to extracellular matrices. CD49d is involved in lymphocyte migration, T cell activation, and hematopoietic stem cell differentiation. CD49d is a marker to isolate pure populations of Treg cells due to its absence on Foxp3+ cells.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green, Baboon, Cat, Cow, Chimpanzee, Common Marmoset, Dog, Horse, Sheep, Squirrel Monkey
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections, and in vitro T cell costimulation2,3. The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 304339 and 304340).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
- Jeong SH, et al. 2004. J. Virol. 78:6995. (Costim)
- Vogel TU, et al. 2002. J. Immunol. 169:4511. (Costim)
- Kleinewietfeld M, et al. 2009. Blood 113:827. (FC) PubMed
- Palacious F, et al. 2010. Blood 115:4488. PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
- Mattapallil MJ, et al. 2011. J. Immunol. 187:1977. PubMed
- RRID
-
AB_2892357 (BioLegend Cat. No. 304349)
Antigen Details
- Structure
- Integrin, type I transmembrane glycoprotein, 150 kD.
- Distribution
-
T cells, B cells, NK , dendritic cells, thymocytes, monocytes, eosinophils, mast cells.
- Function
- Lymphocyte migration, T cell activation, stem cell differentiation.
- Ligand/Receptor
- Fibronectin, VCAM-1, MAdCAM-1
- Cell Type
- B cells, Dendritic cells, Eosinophils, Mast cells, Monocytes, NK cells, T cells, Thymocytes, Tregs
- Biology Area
- Cell Adhesion, Cell Biology, Immunology, Innate Immunity
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Elices M, Ed.1995. Springer Semin. Immunopathol. 16(4).
2. Lobb RR and Helmer ME. et al. 1994. J. Clin. Invest. 94:1722. - Gene ID
- 3676 View all products for this Gene ID
- UniProt
- View information about CD49d on UniProt.org
Other Formats
View All CD49d Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD49d
-
PE anti-human CD49d
-
PE/Cyanine5 anti-human CD49d
-
Purified anti-human CD49d
-
Alexa Fluor® 594 anti-human CD49d
-
PerCP/Cyanine5.5 anti-human CD49d
-
PE/Cyanine7 anti-human CD49d
-
FITC anti-human CD49d
-
Brilliant Violet 510™ anti-human CD49d
-
Brilliant Violet 421™ anti-human CD49d
-
Purified anti-human CD49d (Maxpar® Ready)
-
Brilliant Violet 605™ anti-human CD49d
-
PE/Dazzle™ 594 anti-human CD49d
-
APC/Cyanine7 anti-human CD49d
-
Brilliant Violet 711™ anti-human CD49d
-
Alexa Fluor® 647 anti-human CD49d
-
Biotin anti-human CD49d
-
TotalSeq™-A0576 anti-human CD49d
-
Brilliant Violet 785™ anti-human CD49d
-
APC/Fire™ 750 anti-human CD49d
-
Ultra-LEAF™ Purified anti-human CD49d
-
TotalSeq™-C0576 anti-human CD49d
-
TotalSeq™-B0576 anti-human CD49d Antibody
-
TotalSeq™-D0576 anti-human CD49d
-
APC/Fire™ 750 anti-human CD49d
Follow Us