- Clone
- S-HCL-3 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Integrin αX subunit, CR4, p150, ITGAX
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- TACGCCTATAACTTG
- Ave. Rating
- Submit a Review
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
371527 | 10 µg | 296€ |
CD11c is a 145-150 kD type I transmembrane glycoprotein also known as integrin αx and CR4. CD11c non-covalently associates with integrin β2 (CD18) and is expressed on monocytes/macrophages, dendritic cells, granulocytes, NK cells, and subsets of T and B cells. CD11c has been reported to play a role in adhesion and CTL killing through its interactions with fibrinogen, CD54, and iC3b.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Spleen cells from patient diagnosed with hairy cell leukemia.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemistry on frozen tissue sections1,2,3,4 and immunoprecipitation1.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna.
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Schwarting R, et al. 1985. Blood 65:974.
- Knowles DM, et al. 1990. Am. J. Pathol. 136:29.
- Vandenabeele S, et al. 2001. Blood 97:1733.
- Shaw JL, et al. 2011. J. Reprod. Immunol. 89:84.
- RRID
-
AB_2894601 (BioLegend Cat. No. 371527)
Antigen Details
- Structure
- Integrin, type I transmembrane glycoprotein, associates with integrin ß2 (CD18), 145-150 kD.
- Distribution
-
Myeloid, dendritic cells, NK cells, B cells and T cell subsets.
- Function
- Adhesion and CTL killing.
- Interaction
- Interacts with fibrinogen, CD54, and iC3b.
- Ligand/Receptor
- CD54, fibrinogen, iC3b, ICAM-1, ICAM-4
- Cell Type
- B cells, Dendritic cells, NK cells, T cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Petty HR, Todd RF 3rd. 1996. Immunol. Today 17:209.
2. Springer T. 1994. Cell 76:301.
3. Ihanus E, et al. 2007. Blood 109:802-10. - Gene ID
- 3687 View all products for this Gene ID
- UniProt
- View information about CD11c on UniProt.org
Related FAQs
Other Formats
View All CD11c Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD11c | S-HCL-3 | FC,IHC-F,IP |
APC anti-human CD11c | S-HCL-3 | FC |
PE anti-human CD11c | S-HCL-3 | FC |
PE/Cyanine7 anti-human CD11c | S-HCL-3 | FC |
Brilliant Violet 421™ anti-human CD11c | S-HCL-3 | FC |
APC/Fire™ 750 anti-human CD11c | S-HCL-3 | FC |
FITC anti-human CD11c | S-HCL-3 | FC |
PerCP/Cyanine5.5 anti-human CD11c | S-HCL-3 | FC |
Brilliant Violet 510™ anti-human CD11c | S-HCL-3 | FC |
TotalSeq™-A0053 anti-human CD11c | S-HCL-3 | PG |
TotalSeq™-C0053 anti-human CD11c | S-HCL-3 | PG |
TotalSeq™-B0053 anti-human CD11c | S-HCL-3 | PG |
Alexa Fluor® 647 anti-human CD11c Antibody | S-HCL-3 | FC |
TotalSeq™-D0053 anti-human CD11c | S-HCL-3 | PG |
Spark Blue™ 550 anti-human CD11c (Flexi-Fluor™) | S-HCL-3 | FC |
Spark Red™ 718 anti-human CD11c (Flexi-Fluor™) | S-HCL-3 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD11c
Human peripheral blood granulocytes were stained with purifi... -
APC anti-human CD11c
Human peripheral blood granulocytes were stained with CD11c ... -
PE anti-human CD11c
Human peripheral blood granulocytes were stained with CD11c ... -
PE/Cyanine7 anti-human CD11c
Human peripheral blood granulocytes were stained with CD11c ... -
Brilliant Violet 421™ anti-human CD11c
Human peripheral blood granulocytes were stained with CD11c ... -
APC/Fire™ 750 anti-human CD11c
Human peripheral blood granulocytes were stained with CD11c ... -
FITC anti-human CD11c
Human peripheral blood granulocytes were stained with CD11c ... -
PerCP/Cyanine5.5 anti-human CD11c
Human peripheral blood granulocytes were stained with CD11c ... -
Brilliant Violet 510™ anti-human CD11c
Human peripheral blood granulocytes were stained with CD11c ... -
TotalSeq™-A0053 anti-human CD11c
-
TotalSeq™-C0053 anti-human CD11c
-
TotalSeq™-B0053 anti-human CD11c
-
Alexa Fluor® 647 anti-human CD11c Antibody
Human peripheral blood granulocytes were stained with anti-h... -
TotalSeq™-D0053 anti-human CD11c
-
Spark Blue™ 550 anti-human CD11c (Flexi-Fluor™)
-
Spark Red™ 718 anti-human CD11c (Flexi-Fluor™)
Follow Us