- Clone
- DCN.70 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- B7RP2
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GACTGGGAGGGTATT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
331609 | 10 µg | $369 |
B7-H3 is a member of the B7 gene family. It has 88% amino acid sequence identity with mouse B7-H3. It is mostly expressed on professional APCs, including B cells, macrophages, and dendritic cells. Its expression on dendritic cells appears to be up-regulated by LPS. B7-H3 protein inhibits T cell activation and cytokine production. It was reported that monoclonal antibody against B7-H3 enhanced T cell proliferation in vitro and led to exacerbated EAE in vivo. Therefore, B7-H3 may be a negative regulator on T cell activation and function.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2892401 (BioLegend Cat. No. 331609)
Antigen Details
- Structure
- About 49.7 KD transmembrane protein characterized by extracellular IgV and IgC domains.
- Distribution
-
B7-H3 is expressed on professional APCs, including B cells, dendritic cells, and macrophages. It is reported to express on a minor fraction of CD4+ and CD8+ cells.
- Ligand/Receptor
- The receptor has not been identified, but it seems to be expressed on activated T cells.
- Bioactivity
- B7-H3 is a negative regulator of T cell activation and IL-2 production.
- Cell Type
- Antigen-presenting cells, B cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Sun M, et al. 2002. J. Immunology. 168:6294
2. Xu J, et al. 2006. Cellular and Molecular Immunology. 3:235 - Gene ID
- 80381 View all products for this Gene ID
- UniProt
- View information about CD276 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD276 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD276 (B7-H3) | DCN.70 | FC |
PE anti-human CD276 (B7-H3) | DCN.70 | FC |
TotalSeq™-A0010 anti-human CD276 (B7-H3) | DCN.70 | PG |
TotalSeq™-D0010 anti-human CD276 (B7-H3) | DCN.70 | PG |
TotalSeq™-C0010 anti-human CD276 (B7-H3) | DCN.70 | PG |
TotalSeq™-B0010 anti-human CD276 (B7-H3) | DCN.70 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us