TotalSeq™-D0020 anti-human CD270 (HVEM, TR2) Antibody

Pricing & Availability
Clone
122 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
TR2, Herpesvirus entry mediator A, Tumor necrosis factor receptor superfamily, member 14, TNFRSF14, Tumor necrosis factor receptor like 2, HVEM
Isotype
Mouse IgG1, κ
Barcode Sequence
TGATAGAAACAGACC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
318821 10 µg $369
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The 122 antibody recognizes human HVEM also known as herpesvirus entry mediator A, tumor necrosis factor receptor superfamily, member 14, TNFRSF14, and tumor necrosis factor receptor like 2. HVEM, a member of the TNFR superfamily, is a type I transmembrane protein containing 2 TNF receptor domains with a predicted molecular weight of approximately 30 kD. HVEM is widely expressed in blood vessels, brain, heart, kidney, liver, lung, prostate, spleen, thymus and other organs. Resting T cells and naïve and memory B cells express high levels of HVEM as well. In humans, HVEM is not expressed in germinal center B cells. Immature dendritic cells express high levels of HVEM that is downregulated upon maturation. HVEM plays an important role in herpes simplex virus pathogenesis by enhancing entry into cells. Signaling through HVEM activates JNK1, NF-κB and AP-1 to control gene expression in response to infection or cellular stress and activate the immune response. HVEM binds to LIGHT and has also been shown to associate with several other proteins including TRAF1, TRAF2, TRAF3, TRAF5, B and T lymphocyte associated protein (BTLA), and estrogen receptor alpha.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Recombinant human HVEM protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

 


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 122 antibody has been shown to be useful for flow cytometry, Western blot, and ELISA.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Cheung TC, et al. 2010. J. Immunol. 185:1949. PubMed
  2. Hobo W, et al. 2012. J Immunol. 189:39. PubMed.
RRID
AB_2894618 (BioLegend Cat. No. 318821)

Antigen Details

Structure
Member of the TNFR superfamily, type I transmembrane protein containing 2 TNF receptor domains. Predicted molecular weight approximately 30 kD.
Distribution

Widely expressed in blood vessels, brain, heart, kidney, liver, lung, prostate, spleen, thymus and other organs. Resting T cells and naïve and memory B cells express high levels of HVEM. Immature dendritic cells express high levels of HVEM that is downregulated upon maturation.

Function
Plays an important role in herpes simplex virus pathogenesis by enhancing entry into cells. Signaling through HVEM activates JNK1, NF-κB and AP-1 to control gene expression in response to infection or cellular stress and activate the immune response.
Interaction
TRAF1, TRAF2, TRAF3, TRAF5, B and T lymphocyte associated protein (BTLA), and estrogen receptor alpha have been shown to directly interact with HVEM in vivo.
Ligand/Receptor
LIGHT (TNFSF14), LTα
Cell Type
B cells, Dendritic cells, T cells
Biology Area
Cell Adhesion, Cell Biology, Immunology, Signal Transduction
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Carfi A, et al. 2001. Molec. Cell 8:169.
2. Gonzalez LC, et al. 2005.Proc. Nat. Acad. Sci. 102:1116.
3. Kwon BS, et al. 1997. J. Biol. Chem. 272:13471.
4. Marsters SA, et al. 1997. J. Biol. Chem. 272:14272.
5. Montgomery RI, et al. 1996. Cell 87:427.

Gene ID
8764 View all products for this Gene ID
UniProt
View information about CD270 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 07/09/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login/Register
Remember me
Forgot your password? Reset Password
Request an Account