- Clone
- SKII.4 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Poliovirus receptor (PVR), nectin-like 5
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- ATCACATCGTTGCCA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
337639 | 10 µg | $369 |
CD155, known as poliovirus receptor (PVR) or nectin-like 5, is a 70 kD type I transmembrane glycoprotein. It is a nectin-like molecule belonging to Ig superfamily. CD155 is primarily found on endothelial cells, monocytes, epithelia and central nervous system. CD155 is an adhesion molecule involved in cell-cell and cell-matrix adhesion through interaction with CD226, CD96 (Tactile), nectin-1, -2, and -3 (CD111, CD112, CD113), and vitronectin. It also serves as a receptor for poliovirus and cytomegalovirus.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- SK-N-S1 human neuroblastoma cells.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications include: block binding of PVR ligands CD226 and CD96 to PVR, immunoprecipitation, and western blot.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Fuchs A, et al. 2004. J. Immunol. 172:3994
- RRID
-
AB_2892409 (BioLegend Cat. No. 337639)
Antigen Details
- Structure
- Type I glycoprotein, Ig superfamily
- Distribution
-
Monocytes, endothelial cells, epithelia, central nervous system
- Function
- Cell-cell and cell-matrix adhesion
- Ligand/Receptor
- CD226, CD96, nectin-1, -2, and -3, vitronectin, CD155, poliovirus
- Cell Type
- Endothelial cells, Epithelial cells, Monocytes, Tregs
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- Adhesion Molecules, CD Molecules, Immune Checkpoint Receptors
- Antigen References
-
1. Zola H, et al. eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. Wiely-Liss A John Wiley & Sons Inc, Publication
2. Bottino PD, et al. 2005. Mol. Immunol. 42:463
3. Tahara-Hanaoka S, et al. 2004. Intl. Immunol. 16:533 - Gene ID
- 5817 View all products for this Gene ID
- UniProt
- View information about CD155 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD155 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human CD155 (PVR) | SKII.4 | FC |
Purified anti-human CD155 (PVR) | SKII.4 | FC,WB,IP |
PerCP/Cyanine5.5 anti-human CD155 (PVR) | SKII.4 | FC |
PE/Cyanine7 anti-human CD155 (PVR) | SKII.4 | FC |
PE/Dazzle™ 594 anti-human CD155 (PVR) | SKII.4 | FC |
APC anti-human CD155 (PVR) | SKII.4 | FC |
Alexa Fluor® 647 anti-human CD155 (PVR) | SKII.4 | FC |
Biotin anti-human CD155 (PVR) | SKII.4 | FC |
TotalSeq™-A0023 anti-human CD155 (PVR) | SKII.4 | PG |
APC/Fire™ 750 anti-human CD155 (PVR) | SKII.4 | FC |
Brilliant Violet 510™ anti-human CD155 (PVR) | SKII.4 | FC |
Brilliant Violet 421™ anti-human CD155 (PVR) | SKII.4 | FC |
FITC anti-human CD155 (PVR) | SKII.4 | FC |
Alexa Fluor® 700 anti-human CD155 (PVR) | SKII.4 | FC |
TotalSeq™-B0023 anti-human CD155 (PVR) | SKII.4 | PG |
TotalSeq™-C0023 anti-human CD155 (PVR) | SKII.4 | PG |
TotalSeq™-D0023 anti-human CD155 (PVR) | SKII.4 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD155 (PVR)
-
Purified anti-human CD155 (PVR)
-
PerCP/Cyanine5.5 anti-human CD155 (PVR)
-
PE/Cyanine7 anti-human CD155 (PVR)
-
PE/Dazzle™ 594 anti-human CD155 (PVR)
-
APC anti-human CD155 (PVR)
-
Alexa Fluor® 647 anti-human CD155 (PVR)
-
Biotin anti-human CD155 (PVR)
-
TotalSeq™-A0023 anti-human CD155 (PVR)
-
APC/Fire™ 750 anti-human CD155 (PVR)
-
Brilliant Violet 510™ anti-human CD155 (PVR)
-
Brilliant Violet 421™ anti-human CD155 (PVR)
-
FITC anti-human CD155 (PVR)
-
Alexa Fluor® 700 anti-human CD155 (PVR)
-
TotalSeq™-B0023 anti-human CD155 (PVR)
-
TotalSeq™-C0023 anti-human CD155 (PVR)
-
TotalSeq™-D0023 anti-human CD155 (PVR)
Follow Us