TotalSeq™-D0031 anti-human CD40 Antibody

Pricing & Availability
Clone
5C3 (See other available formats)
Regulatory Status
RUO
Workshop
V CD40.4
Other Names
BP50, TNFRSF5
Isotype
Mouse IgG1, κ
Barcode Sequence
CTCAGATGGAGTATG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
334354 10 µg $358
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD40 is a 48 kD type I glycoprotein also known as BP50. It is a member of the TNFR superfamily primarily expressed on B cells, macrophages, follicular dendritic cells, endothelial cells, fibroblasts, and at low levels on plasma cells. CD40 has been reported to be involved in B cell differentiation, costimulation, isotype class-switching, and protection of B cells from apoptosis. Additionally, CD40 is important for T cell-B cell interactions. The ligand of CD40 is CD154 (CD40 ligand). The 5C3 antibody has been reported to promote B cell proliferation in the presence of anti-IgM, IL-4 or PMA, partially blocking CD40 binding to CD40L, and B cells rescue from apoptosis.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
Baboon, Chimpanzee, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: costimulation of B cell proliferation1, partial inhibition of CD40 binding to CD40L3, and B cell rescue from apoptosis1. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman SF, et al. 1995. ed. Leukocyte Typing V:White Cell Differentiation Antigens. New York:Oxford University Press.
  2. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  3. Pound JD, et al. 1999. Int. Immunol. 11:11.
  4. Shey MS, et al. 2014. J Immunol. 192:4833. PubMed
  5. Sondergaard JN, et al. 2014. Mol Immunol. 59:180. PubMed
  6. Saiki O, et al. 1995. J Clin. Invest. 2: 510-4 (Costim)
RRID
AB_2924539 (BioLegend Cat. No. 334354)

Antigen Details

Structure
TNFR superfamily, type I glycoprotein, 48 kD
Distribution

B cells, macrophages, follicular dendritic cells, endothelial cells, fibroblasts

Function
B cell differentiation, costimulation, isotype class-switching, rescues B cells from apoptosis
Ligand/Receptor
CD154 (CD40 ligand)
Cell Type
B cells, Dendritic cells, Endothelial cells, Fibroblasts, Macrophages
Biology Area
Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Banchereau J, et al. 1994. Annu. Rev. Immunol. 12:881.
2. Foy T, et al. 1996. Annu. Rev. Immunol. 14:591.

Gene ID
958 View all products for this Gene ID
UniProt
View information about CD40 on UniProt.org
Go To Top Version: 1    Revision Date: 09/02/2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login/Register
Remember me
Forgot your password? Reset Password
Request an Account