Loading...

TotalSeq™-D0068 anti-human CD105 Antibody

Pricing & Availability
Clone
43A3 (See other available formats)
Regulatory Status
RUO
Other Names
Endoglin
Isotype
Mouse IgG1, κ
Barcode Sequence
ATCGTCGAGAGCTAG
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
323231 10 µg $369
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD105 is also known as Endoglin. It is a type I integral membrane homodimer protein with subunits of 90 kD found on vascular endothelial cells and syncytiotrophoblasts of placenta. CD105 is weakly expressed on stromal fibroblasts. It is also expressed on activated monocytes and tissue macrophages. Expression of CD105 is increased on activated endothelium in tissues undergoing angiogenesis, such as in tumors, or in cases of wound healing or dermal inflammation. CD105 is a component of the TGF-β receptor system in human umbilical vein endothelial cells and binds TGF-β1 and β3 with high affinity but does not bind to TGF-β2.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
L-cells transfected with human CD105
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Bühring HJ, et al. 1991. Leukemia 5:841.
  2. Vogel W, et al. 2002. Haematologica 88:126.
  3. Osaka M, et al. 2011. Brain Res. 9:1343. PubMed
  4. HonMou O, et al. 2011. Brain. 134:1790. PubMed
  5. Herrera MB, et al. 2013. Hepatology. 57:311. PubMed
  6. Iohara K, et al. 2014. Exp Gerontol. 52:39. PubMed
RRID
AB_2936590 (BioLegend Cat. No. 323231)

Antigen Details

Structure
Associates with TGF-ß receptor I and II, homodimeric type I integral membrane protein, 90 kD
Distribution

Endothelial cells, activated monocytes/macrophages, bone marrow stromal cells, hematopoietic stem/progenitor cells

Function
Modulates cellular response to TGF-ß, involved in vascular development and remodelling
Ligand/Receptor
TGF-ß1, TGF-ß3
Cell Type
Endothelial cells, Hematopoietic stem and progenitors, Macrophages, Mesenchymal Stem Cells, Monocytes
Biology Area
Angiogenesis, Cell Biology, Immunology, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Mason D, et al. Eds. 2002. Leucocyte Typing VII. Oxford University Press. New York.
2. Pierelli L, et al. 2001. Leuk. Lymphoma 42:1195.

Gene ID
2022 View all products for this Gene ID
UniProt
View information about CD105 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 01/31/2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login/Register
Remember me
Forgot your password? Reset Password
Request an Account