IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0092 Mouse IgG2b, κ Isotype Ctrl Antibody

Pricing & Availability
Clone
MPC-11 (See other available formats)
Regulatory Status
RUO
Isotype
Mouse IgG2b, κ
Barcode Sequence
ATATGTATCACGCGA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
400383 10 µg $369
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The MPC-11 immunoglobulin has unknown specificity. This antibody was chosen as an isotype control after screening on a variety of resting, activated, live, and fixed mouse, rat and human tissues.

Product Details
Technical data sheet

Product Details

Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Intracellular Flow Cytometry (ICFC), Immunocytochemistry (ICC), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western Blotting (WB), Functional Assay (FA).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Smed-Sörensen A, et al. 2008. Blood 111:5037. (FA) PubMed
  2. Podolin PL, et al. 2008. J. Immunol. 180:7989. (FC) PubMed
Product Citations
  1. Sun W, et al. 2023. Nature. 614:309. PubMed
RRID
AB_3097118 (BioLegend Cat. No. 400383)

Antigen Details

Gene ID
NA

Related FAQs

There are no FAQs for this product.

Other Formats

View All Reagents Request Custom Conjugation
Description Clone Applications
APC Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Biotin Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
FITC Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
PE Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
PE/Cyanine5 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Purified Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC,ICC,IHC,IP,WB,FA,ChIP
APC/Cyanine7 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Alexa Fluor® 647 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Alexa Fluor® 488 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Alexa Fluor® 700 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
PerCP Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Brilliant Violet 421™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Brilliant Violet 570™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Brilliant Violet 510™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Ultra-LEAF™ Purified Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC,ICC,IHC,IP,WB,FA
Brilliant Violet 605™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Brilliant Violet 650™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Brilliant Violet 711™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Brilliant Violet 785™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
PE/Dazzle™ 594 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
Alexa Fluor® 594 Mouse IgG2b, κ Isotype Ctrl MPC-11 ICC
APC/Fire™ 750 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
GoInVivo™ Purified Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC,ICC,IHC,IP,WB,FA
FITC Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
APC Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
TotalSeq™-A0092 Mouse IgG2b, κ isotype Ctrl MPC-11 PG
PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
TotalSeq™-B0092 Mouse IgG2b, κ isotype Ctrl MPC-11 PG
TotalSeq™-C0092 Mouse IgG2b, κ isotype Ctrl MPC-11 PG
PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
TotalSeq™-D0092 Mouse IgG2b, κ Isotype Ctrl MPC-11 PG
GMP APC Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
GMP FITC Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
GMP Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
GMP PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
Brilliant Violet 750™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Spark NIR 685™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
PE/Fire™ 810 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
TotalSeq™-Bn0092 Mouse IgG2b, κ Isotype Ctrl MPC-11 SB
PE/Fire™ 700 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
KIRAVIA Blue 520™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
PE/Fire™ 640 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
GMP PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
APC/Fire™ 810 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Spark YG™ 570 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
PerCP/Fire™ 806 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
Spark Red™ 718 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Spark Blue™ 515 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
PerCP/Fire™ 780 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
PE/Fire™ 744 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
Spark PLUS UV395™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC,ICFC
TotalSeq™-B1473 Mouse IgG2b, κ Isotype Ctrl MPC-11 ICPG
Go To Top Version: 1    Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC Mouse IgG2b, κ Isotype Ctrl

  • Biotin Mouse IgG2b, κ Isotype Ctrl

  • FITC Mouse IgG2b, κ Isotype Ctrl

  • PE Mouse IgG2b, κ Isotype Ctrl

  • PE/Cyanine5 Mouse IgG2b, κ Isotype Ctrl

  • Purified Mouse IgG2b, κ Isotype Ctrl

    MPC-11_ChIP_IgG2b-k_ctrl_1_060618_updated.png
    Chromatin Immunoprecipitations (ChIP) were performed with cr...
    MPC-11_ChIP_IgG2b-k_ctrl_2_060618_updated.png
    Chromatin Immunoprecipitations (ChIP) were performed with cr...
  • APC/Cyanine7 Mouse IgG2b, κ Isotype Ctrl

  • PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 647 Mouse IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 488 Mouse IgG2b, κ Isotype Ctrl

  • Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 700 Mouse IgG2b, κ Isotype Ctrl

  • PerCP Mouse IgG2b, κ Isotype Ctrl

    MPC-11_PerCP_122607
    Human peripheral blood lymphocytes stained with MPC-11 PerCP
  • PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl

    MPC-11_PerCPCy55_122607
    Human peripheral blood lymphocytes stained with MPC-11 PerCP...
  • Brilliant Violet 421™ Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 570™ Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 510™ Mouse IgG2b, κ Isotype Ctrl

  • Ultra-LEAF™ Purified Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 605™ Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 650™ Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 711™ Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 785™ Mouse IgG2b, κ Isotype Ctrl

  • PE/Dazzle™ 594 Mouse IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 594 Mouse IgG2b, κ Isotype Ctrl

  • APC/Fire™ 750 Mouse IgG2b, κ Isotype Ctrl

  • GoInVivo™ Purified Mouse IgG2b, κ Isotype Ctrl

  • FITC Mouse IgG2b, κ Isotype Ctrl

  • Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl

  • APC Mouse IgG2b, κ Isotype Ctrl

  • TotalSeq™-A0092 Mouse IgG2b, κ isotype Ctrl

  • PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl

  • TotalSeq™-B0092 Mouse IgG2b, κ isotype Ctrl

  • TotalSeq™-C0092 Mouse IgG2b, κ isotype Ctrl

  • PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl

  • TotalSeq™-D0092 Mouse IgG2b, κ Isotype Ctrl

  • GMP APC Mouse IgG2b, κ Isotype Ctrl

  • GMP FITC Mouse IgG2b, κ Isotype Ctrl

  • GMP Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl

  • GMP PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 750™ Mouse IgG2b, κ Isotype Ctrl

  • Spark NIR 685™ Mouse IgG2b, κ Isotype Ctrl

  • PE/Fire™ 810 Mouse IgG2b, κ Isotype Ctrl

  • TotalSeq™-Bn0092 Mouse IgG2b, κ Isotype Ctrl

  • PE/Fire™ 700 Mouse IgG2b, κ Isotype Ctrl

  • KIRAVIA Blue 520™ Mouse IgG2b, κ Isotype Ctrl

  • PE/Fire™ 640 Mouse IgG2b, κ Isotype Ctrl

  • GMP PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl

  • APC/Fire™ 810 Mouse IgG2b, κ Isotype Ctrl

  • Spark YG™ 570 Mouse IgG2b, κ Isotype Ctrl

  • PerCP/Fire™ 806 Mouse IgG2b, κ Isotype Ctrl

  • Spark Red™ 718 Mouse IgG2b, κ Isotype Ctrl

  • Spark Blue™ 515 Mouse IgG2b, κ Isotype Ctrl

  • PerCP/Fire™ 780 Mouse IgG2b, κ Isotype Ctrl

  • PE/Fire™ 744 Mouse IgG2b, κ Isotype Ctrl

  • Spark PLUS UV395™ Mouse IgG2b, κ Isotype Ctrl

  • TotalSeq™-B1473 Mouse IgG2b, κ Isotype Ctrl

ProductsHere

Login/Register
Remember me
Forgot your password? Reset Password
Request an Account