TotalSeq™-D0139 anti-human TCR γ/δ antibody, TCR γ/δ, B1

Pricing & Availability

Clone: B1 (See other available formats)
Regulatory Status: RUO
Other Names: T cell receptor γ/δ, γ/δ TCR, TCR-γ/δ
Isotype: Mouse IgG1, κ
Barcode Sequence: CTTCCGATTCATTCA
Ave. Rating: Submit a Review
Product Citations: publications

Compare all formats

Cat #

Size

Price

Quantity Check Availability

Save

331241

10 µg

$369

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

T cell receptor (TCR) is a heterodimer consisting of an α and a β chain (TCR α/β) or a γ and a δ chain (TCR γ/δ). TCR γ/δ is involved in the recognition of certain bacterial, self-CD1 molecule, and tumor antigens bound to MHC class I. The γ/δ TCR associates with CD3 and is expressed on a subset of T cells found in the thymus, the intestinal epithelium, and the peripheral lymphoid tissues and peritoneum. Most γ/δ T cells are CD4^-/CD8^-, some are CD8⁺. T cells expressing the γ/δ TCR have been shown to play a role in oral tolerance, innate immune response for some tumor cells, and autoimmune disease. It has been reported that γ/δ T cells also play a principal role in antigen presentation.

Product Details

Technical data sheet

Product Details

Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: African Green, Baboon, Pigtailed Macaque
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Clone B1 is also known as clone B1.1.

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections³ and paraffin-embedded sections⁵, in vitro blocking, and spatial biology (IBEX)^8,9. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for highly sensitive assays (Cat. Nos. 331235 and 331236).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2892399 (BioLegend Cat. No. 331241)

Antigen Details

Structure: Ig superfamily, associates with CD3 complex
Distribution: T subset in thymus, intestinal epithelium, peripheral lymphoid tissues and peritoneum
Function: Antigen recognition
Ligand/Receptor: Some bacterial or tumor antigens bound MHC class I, CD1 molecule
Cell Type: Epithelial cells, T cells
Biology Area: Adaptive Immunity, Immunology
Molecular Family: TCRs
Antigen References: 1. Lanier LL, et al. 1987. J. Clin. Immunol. 7:429.
2. Spencer J, et al. 1989. Eur. J. Immunol. 19:1335.
3. Uyemura K, et al. 1991. J. Exp. Med. 174:683.
4. Spada FM, et al. 2000. J. Exp. Med. 191:907.
Gene ID: 6964 View all products for this Gene ID 6965 View all products for this Gene ID
UniProt: View information about TCR gamma/delta on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

Related FAQs

There are no FAQs for this product.

Other Formats

View All TCR γ/δ Reagents Request Custom Conjugation

Description	Clone	Applications
Purified anti-human TCR γ/δ	B1	FC,IHC
Biotin anti-human TCR γ/δ	B1	FC,IHC
FITC anti-human TCR γ/δ	B1	FC
PE anti-human TCR γ/δ	B1	FC,SB
APC anti-human TCR γ/δ	B1	FC
Alexa Fluor® 647 anti-human TCR γ/δ	B1	FC
Brilliant Violet 421™ anti-human TCR γ/δ	B1	FC
Brilliant Violet 510™ anti-human TCR γ/δ	B1	FC
PE/Cyanine7 anti-human TCR γ/δ	B1	FC
PerCP/Cyanine5.5 anti-human TCR γ/δ	B1	FC
PE/Dazzle™ 594 anti-human TCR γ/δ	B1	FC
APC/Fire™ 750 anti-human TCR γ/δ	B1	FC
TotalSeq™-A0139 anti-human TCR γ/δ	B1	PG
TotalSeq™-C0139 anti-human TCR γ/δ	B1	PG
TotalSeq™-B0139 anti-human TCR γ/δ	B1	PG
Ultra-LEAF™ Purified anti-human TCR γ/δ	B1	FC,FA,IHC,Block
PE/Fire™ 700 anti-human TCR γ/δ Antibody	B1	FC
Alexa Fluor® 660 anti-human TCR γ/δ Antibody	B1	FC
TotalSeq™-D0139 anti-human TCR γ/δ	B1	PG
PE/Fire™ 810 anti-human TCR γ/δ	B1	FC
Brilliant Violet 650™ anti-human TCR γ/δ	B1	FC
Brilliant Violet 785™ anti-human TCR γ/δ	B1	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.