- Clone
- 7C9 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Sialic acid-binding Ig-like lectin 8 (Siglec-8), Siglec8L, Sialoadhesin family member 2 (SAF2)
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CTTCTCCTCAGCAAT
- Ave. Rating
- Submit a Review
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
347117 | 10 µg | $369 |
Siglec-8 is a lectin specific for 6'-sulfo-sLex and a member of the Ig-superfamily. It is expressed almost exclusively in eosinophils; however, basophils and mast cells can express it to a lower degree. Siglec-8 is a 54 kD transmembranal protein; the extracellular domain has one V-set Ig-like domain and two C2-set domains. The cytoplasmic domain has two immunoreceptor tyrosine-based inhibitor motifs (ITIM) that recruit SH2-family phosphatases after tyrosine phosphorylation. There are reports that siglec-8 inhibits the release of histamine and prostaglandin D2 mediated by the IgEFcR. This molelcule is also involved in the induction of apoptosis.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Recombinant Siglec-8 fused to human IgG Fc
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Floyd H, et al. 2000. J. Biol. Chem. 275:861.
- Wen T, et al. 2014. J Immunol. 192:5481. PubMed
- RRID
-
AB_2904369 (BioLegend Cat. No. 347117)
Antigen Details
- Structure
- A lectin of 54 kD, belonging to the Ig-superfamily; has one V-set Ig-like domain and two C2-set domains; has a single transmembrane domain, and two immunoreceptor tyrosine-based inhibitor motifs (ITIM) in the cytoplasmic domain
- Distribution
-
Eosinophils, basophils, mast cells
- Function
- Cell adhesion, signal transduction
- Interaction
- Phosphatases containing a SH2 domain
- Bioactivity
- Inhibition of IgE receptor-triggered histamine and prostaglandin D2 release, apoptosis
- Cell Type
- Basophils, Eosinophils, Mast cells
- Biology Area
- Cell Adhesion, Cell Biology, Immunology, Signal Transduction
- Molecular Family
- Adhesion Molecules, Siglec Molecules
- Antigen References
-
1. Bochner BS, et al. 2009. Clin. Exp. Allergy. 39:317.
2. Hudson SA, et al. 2009. J. Pharmacol. Exp. Ther. 330:608.
3. Nutku E, et al. 2005. Biochem. Biophys. Res. Commun. 336:918. - Gene ID
- 27181 View all products for this Gene ID
- UniProt
- View information about Siglec-8 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All Siglec-8 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human Siglec-8 | 7C9 | FC |
PE anti-human Siglec-8 | 7C9 | FC |
APC anti-human Siglec-8 | 7C9 | FC |
PE/Dazzle™ 594 anti-human Siglec-8 | 7C9 | FC |
PE/Cyanine7 anti-human Siglec-8 | 7C9 | FC |
PerCP/Cyanine5.5 anti-human Siglec-8 | 7C9 | FC |
TotalSeq™-C0199 anti-human Siglec-8 | 7C9 | PG |
PE/Cyanine5 anti-human Siglec-8 | 7C9 | FC |
TotalSeq™-D0199 anti-human Siglec-8 | 7C9 | PG |
Biotin anti-human Siglec-8 | 7C9 | FC |
Alexa Fluor® 647 anti-human Siglec-8 | 7C9 | FC |
TotalSeq™-A0199 anti-human Siglec-8 | 7C9 | PG |
KIRAVIA Blue 520™ anti-human Siglec-8 | 7C9 | FC |
TotalSeq™-B0199 anti-human Siglec-8 | 7C9 | PG |
Spark Red™ 718 anti-human Siglec-8 (Flexi-Fluor™) | 7C9 | FC |
Spark Blue™ 574 anti-human Siglec-8 (Flexi-Fluor™) | 7C9 | FC |
Spark Blue™ 550 anti-human Siglec-8 (Flexi-Fluor™) | 7C9 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human Siglec-8
Human peripheral blood cells stained with anti-human CCR3 Al... -
PE anti-human Siglec-8
Human peripheral blood leukocytes were stained with CCR3 APC... -
APC anti-human Siglec-8
Human peripheral blood leukocytes were stained with CCR3 PE ... -
PE/Dazzle™ 594 anti-human Siglec-8
Human peripheral blood leukocytes were stained with CCR3 APC... -
PE/Cyanine7 anti-human Siglec-8
Human peripheral blood leukocytes were stained with CCR3 FIT... -
PerCP/Cyanine5.5 anti-human Siglec-8
Human peripheral blood leukocytes were stained with CD193 (... -
TotalSeq™-C0199 anti-human Siglec-8
-
PE/Cyanine5 anti-human Siglec-8
Human peripheral blood granulocytes were stained for CD193 F... -
TotalSeq™-D0199 anti-human Siglec-8
-
Biotin anti-human Siglec-8
Human peripheral blood granulocytes were stained with anti-h... -
Alexa Fluor® 647 anti-human Siglec-8
Human peripheral blood leukocytes were stained with anti-hum... -
TotalSeq™-A0199 anti-human Siglec-8
-
KIRAVIA Blue 520™ anti-human Siglec-8
Human peripheral blood leukocytes were stained with anti-hum... -
TotalSeq™-B0199 anti-human Siglec-8
-
Spark Red™ 718 anti-human Siglec-8 (Flexi-Fluor™)
-
Spark Blue™ 574 anti-human Siglec-8 (Flexi-Fluor™)
-
Spark Blue™ 550 anti-human Siglec-8 (Flexi-Fluor™)
Follow Us