TotalSeq™-D0357 anti-human CD43 Antibody

Product Details

Verified Reactivity

Human

Reported Reactivity

African Green, Baboon, Cynomolgus

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

MV4-11 cell line

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

 

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)

1. Rosenkranz AR, et al. 1993. Immunology. 80:431
2. Skubitz KM, et al. 1998. J. Leukoc. Biol. 64:800

RRID

AB_2922561 (BioLegend Cat. No. 343211)

Antigen Details

Structure

Single chain, type I transmembrane glycoprotein with abundant O-glycosylation and sialylation sites, 95-130 kD.

Distribution

Most hematopoietic cells, including peripheral T cells, NK cells, granulocytes, monocytes, thymocytes, platelets, plasma cells, activated B cells, and hemotopoietic progenitor cells.

Function

Plays dual roles in cell-cell adhesion and anti-adhesion, costimulation of cell activation and survival, inducing apoptosis of T cells and hematopoietic progenitors.

Ligand/Receptor

CD54, Siglec-1

Biology Area

Immunology

Molecular Family

Adhesion Molecules, CD Molecules

Antigen References

1. Neil Barclay A, et al. 1997. The Leucocyte Antigen Facts Book:Second Edition. Page 238
2. Killeen A, et al. 1987. EMBO J. 6:4029.
3. Thurman EC, et al. 1998. Intl. Immunol. 10:691.
4. Onami TM, et al. 2002. J. Immunol. 168:6022.
5. Tong J, et al. 2004. J. Exp. Med. 199:1277.
6. Jones AT, et al. 1994. J. Immunol. 153:3426.

Gene ID

6693 View all products for this Gene ID

UniProt

View information about CD43 on UniProt.org

Documentation

• Technical data sheet
• Certificate of Analysis
• Safety Data Sheet

Reviews

Related Protocols

• TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Pages & Pathways

Related FAQs

Other Formats

Certificate of Analysis