- Clone
- p282 (H19) (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V S006
- Other Names
- Protectin, H19, 1F-5Ag, HRF20, MACIF, MIRL, P-18
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- AATTAGCCGTCGAGA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
304717 | 10 µg | $369 |
CD59 is a 19-25 kD glycosylphosphatidylinositol (GPI)-anchored glycoprotein also known as protectin, MACIF, and H19. It is broadly expressed on hematopoietic and non-hematopoietic cells. CD59 inhibits the cytolytic activity of complement by binding to C9, inhibiting incorporation into C5b-8, and preventing the terminal steps in complement polymerization of the membrane attack complex. CD59 has also been reported to play a role in T cell activation.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- Baboon, Chimpanzee
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
- RRID
-
AB_2922540 (BioLegend Cat. No. 304717)
Antigen Details
- Structure
- Ly6 superfamily, single chain GPI-linked membrane protein, 19-25 kD
- Distribution
-
All cell types
- Function
- Blocks complement-mediated lysis by inhibiting MAC formation
- Ligand/Receptor
- Complement components C8, C9
- Biology Area
- Cell Biology, Costimulatory Molecules, Immunology, Neuroinflammation, Neuroscience
- Molecular Family
- CD Molecules
- Antigen References
-
1. Davies A, et al. 1993. Immunol. Res. 12:258.
2. Lachmann P. 1991. Immunol. Today 12:312.
3. Liszewski M, et al. 1996. Adv. Immunol. 61:201. - Gene ID
- 966 View all products for this Gene ID
- UniProt
- View information about CD59 on UniProt.org
Related FAQs
Other Formats
View All CD59 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
FITC anti-human CD59 | p282 (H19) | FC |
PE anti-human CD59 | p282 (H19) | FC |
Purified anti-human CD59 | p282 (H19) | FC |
TotalSeq™-A0361 anti-human CD59 | p282 (H19) | PG |
APC anti-human CD59 | p282 (H19) | FC |
TotalSeq™-B0361 anti-human CD59 | p282 (H19) | PG |
TotalSeq™-C0361 anti-human CD59 | p282 (H19) | PG |
TotalSeq™-D0361 anti-human CD59 | p282 (H19) | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD59
Human peripheral blood lymphocytes stained with p282(H19) FI... -
PE anti-human CD59
Human peripheral blood lymphocytes stained with p282 PE Pre-lysed human blood leukocytes were stained with CD59 (clo... -
Purified anti-human CD59
Human peripheral blood lymphocytes stained with purified p28... -
TotalSeq™-A0361 anti-human CD59
-
APC anti-human CD59
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-B0361 anti-human CD59
-
TotalSeq™-C0361 anti-human CD59
-
TotalSeq™-D0361 anti-human CD59
Follow Us