TotalSeq™-D0370 anti-human CD303 (BDCA-2) Antibody

Pricing & Availability
Clone
201A (See other available formats)
Regulatory Status
RUO
Other Names
CLEC4C, CLECSF11, CLECSF7, DLEC, HECL
Isotype
Mouse IgG2a, κ
Barcode Sequence
GAGATGTCCGAATTT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
354245 10 µg $369
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD303, also known as BDCA-2 and CLEC4C, is a 38 kD type II transmembrane glycoprotein. It is a member of the C-type lectin superfamily. CD303 is expressed by plasmacytoid dendritic cells (pDCs) and is involved in cell adhesion, signaling, and antigen capture and processing. Crosslinking of CD303 inhibits the production of IFN-α/β and TLR-9 induced pDCs maturation.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Freeman A, et al. 2014. PLoS One. 9:110928. PubMed
  2. Johnson P, et al. 2015. Clin Cnacer Res. 21:1321. PubMed
RRID
AB_2892429 (BioLegend Cat. No. 354245)

Antigen Details

Structure
Type II transmembrane protein, 38 kD, member of the C-type lectin superfamily
Distribution

Plasmacytoid dendritic cells

Function
Antigen capture, inhibition of IFN α/β production
Cell Type
Dendritic cells
Biology Area
Costimulatory Molecules, Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Jähn PS, et al. 2010. Cell Immunol. 265:15.
2. Graham LM and Brown GD. 2009. Cytokine 48:148.
3. Röck J, et al. 2007. Eur. J. Immunol. 37:3564.
4. Dzionek A, et al. 2001. J. Exp. Med. 194:1823.

Gene ID
170482 View all products for this Gene ID
UniProt
View information about CD303 on UniProt.org

Other Formats

View All CD303 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD303 (BDCA-2) 201A FC
Purified anti-human CD303 (BDCA-2) 201A FC
PE anti-human CD303 (BDCA-2) 201A FC
FITC anti-human CD303 (BDCA-2) 201A FC
PerCP/Cyanine5.5 anti-human CD303 (BDCA-2) 201A FC
Brilliant Violet 421™ anti-human CD303 (BDCA-2) 201A FC
PE/Cyanine7 anti-human CD303 (BDCA-2) 201A FC
Purified anti-human CD303 (BDCA-2) (Maxpar® Ready) 201A FC,CyTOF®
Alexa Fluor® 647 anti-human CD303 (BDCA-2) 201A FC
Biotin anti-human CD303 (BDCA-2) 201A FC
Brilliant Violet 785™ anti-human CD303 (BDCA-2) 201A FC
Brilliant Violet 605™ anti-human CD303 (BDCA-2) 201A FC
PE/Dazzle™ 594 anti-human CD303 (BDCA-2) 201A FC
Alexa Fluor® 700 anti-human CD303 (BDCA-2) 201A FC
Alexa Fluor® 488 anti-human CD303 (BDCA-2) 201A FC
Brilliant Violet 510™ anti-human CD303 (BDCA-2) 201A FC
Brilliant Violet 711™ anti-human CD303 (BDCA-2) 201A FC
APC/Fire™ 750 anti-human CD303 (BDCA-2) 201A FC
APC/Cyanine7 anti-human CD303 (BDCA-2) 201A FC
TotalSeq™-A0370 anti-human CD303 (BDCA-2) 201A PG
TotalSeq™-C0370 anti-human CD303 (BDCA-2) 201A PG
TotalSeq™-B0370 anti-human CD303 (BDCA-2) 201A PG
TotalSeq™-D0370 anti-human CD303 (BDCA-2) 201A PG
Spark Blue™ 550 anti-human CD303 (BDCA-2) (Flexi-Fluor™) 201A FC
Spark Red™ 718 anti-human CD303 (BDCA-2) (Flexi-Fluor™) 201A FC
APC/Fire™ 810 anti-human CD303 (BDCA-2) 201A FC
Spark Violet™ 538 anti-human CD303 (BDCA-2) 201A FC
PerCP/Fire™ 806 anti-human CD303 (BDCA-2) 201A FC
Go To Top Version: 1    Revision Date: 05/25/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login/Register
Remember me
Forgot your password? Reset Password
Request an Account