TotalSeq™-D0398 anti-human CD115 (CSF-1R) Antibody

Pricing & Availability
Clone
9-4D2-1E4 (See other available formats)
Regulatory Status
RUO
Workshop
V MA199
Other Names
M-CSFR,CSF-1R, FMS, CSF-1 Receptor
Isotype
Rat IgG1, κ
Barcode Sequence
AATCACGGTCCTTGT
Ave. Rating
Submit a Review
Cat # Size Price Quantity Check Availability Save
347331 10 µg $369
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CSF-1R, also known as CD115 and M-CSFR, is a single-pass type I membrane protein and member of the platelet-derived growth factor receptor family. Structural studies of CD115 have described an Ig-like extracellular domain, a transmembrane domain, an intracellular juxtamembrane domain, a split tyrosine kinase domain, and a C-terminal tail receptor. Receptor activation induces homodimerization in addition to phosphorylation and ubiquitinylation of intracellular residues. The natural ligands of CD115 include M-CSF and IL-34. CD115 directly influences tissue macrophage and osteoclast differentiation and proliferation. It is expressed on monocytes/macrophages, plasmacytoid and conventional dendritic cells, and osteoclasts.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
C-fms transduced Kirsten strain murine sarcoma virus transformed NRK cells.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

 

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

It has been reported that CD115 can be rapidly internalized, especially when samples are exposed to room temperature.  Approximate 33% decrease in CD115 expression has been observed between 0 and 4 hours after sample collection, while overnight incubation of the cells results in complete CD115 downregulation. Pre-treatment with EDTA and low temperatures (2 to 8°C) helps in maintaining surface expression of CD1151.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Breslin WL, et al. 2013. J Immunol Methods. 390(1-2):1 PubMed
RRID
AB_2922564 (BioLegend Cat. No. 347331)

Antigen Details

Structure
Single-pass type I membrane protein and is 150 kD.
Distribution

Monocytes/macrophages, plasmacytoid and conventional dendritic cells, and osteoclasts.

Ligand/Receptor
Macrophage Colony Stimulating Factor (M-CSF) and IL-34.
Cell Type
Dendritic cells, Macrophages, Monocytes, Osteoclasts
Biology Area
Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Sherr CJ, et al. 1989. Blood 73:1786
2. Roussel MF, et al. 1991. Nature 353:361.
3. Roussel MF, et al. 1989 P. Natl. Acad. Sci. USA 86:7924.

Gene ID
1436 View all products for this Gene ID
UniProt
View information about CD115 on UniProt.org

Related FAQs

Why do I have a weak CD115 staining?

It has been reported that CD115 can be rapidly internalized, especially when samples are exposed to room temperature. Approximate 33% decrease in CD115 expression has been observed between 0 and 4 hours after sample collection, while overnight incubation of the cells results in complete CD115 downregulation.  Pre-treatment with EDTA and low temperatures (2 - 8°C) helps in maintaining surface expression of CD115. In addition, brief fixation of the cells with Fixation Buffer (Cat. No. 420801) for 10 minutes will block CD115 internalization.

Go To Top Version: 1    Revision Date: 03/23/2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.


Login/Register
Remember me
Forgot your password? Reset Password
Request an Account