- Clone
- W7C5 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Gov platelet alloantigen
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CACTTAACTCTGGGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
323313 | 10 µg | $369 |
The W7C5 monoclonal antibody recognizes human CD109 also known as the Gov platelet alloantigen. CD109 is a member of the alpha2-macroglobulin/complement gene family that is a GPI-linked cell surface antigen with a predicted molecular weight approximately 162 kD. CD109 contains a thioester motif characteristic of alpha-2-macroglobulin that undergoes autolytic cleavage under denaturing conditions. CD109 expression has been reported on CD34+ and CD34- bone marrow stem cells, CD34+ cells in the fetal liver, CD34+ acute myeloid leukemia cells, T cell lines, activated T lymphoblasts, activated platelets, and endothelial cells. It is also widely expressed in the brain, uterus, heart, lung, and trachea of adults. The function of CD109 is largely unknown although it has been implicated in refractoriness to platelet transfusion, neonatal alloimmune thrombocytopenia, and post-transfusion purpura.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Cynomolgus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- WERI-RB-1 retinoblastoma cell line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Giesert C, et al. In:Hematopoietic Stem Cells 2002:Genetics and function.
- Orlic D, et al. 2003. Ann. New York Acad. Sci. 996:227.
- Vogel W, et al. 2002. Haematologica 88:126.
- RRID
-
AB_2894679 (BioLegend Cat. No. 323313)
Antigen Details
- Structure
- Member of the alpha2-macroglobulin/complement gene family. GPI-linked cell surface antigen, predicted molecular weight approximately 162 kD.
- Distribution
-
Expressed on CD34+ and CD34- bone marrow stem cells, CD34+ cells in the fetal liver, CD34+ acute myeloid leukemia cells, T cell lines, activated T lymphoblasts, activated platelets, and endothelial cells.
- Function
- Unknown; has been implicated in refractoriness to platelet transfusion, neonatal alloimmune thrombocytopenia, and post-transfusion purpura
- Cell Type
- Hematopoietic stem and progenitors, Leukemia, Platelets, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
- Lin M, et al. 2002. Blood 99:1683.
- Schuh AC, et al. 2002. Blood 99:1692.
- Solomon KR, et al. 2004. Gene 327:171.
- Gene ID
- 135228 View all products for this Gene ID
- UniProt
- View information about CD109 on UniProt.org
Related Pages & Pathways
Pages
Other Formats
View All CD109 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human CD109 | W7C5 | FC |
TotalSeq™-A0817 anti-human CD109 | W7C5 | PG |
TotalSeq™-C0817 anti-human CD109 | W7C5 | PG |
TotalSeq™-B0817 anti-human CD109 Antibody | W7C5 | PG |
TotalSeq™-D0817 anti-human CD109 Antibody | W7C5 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us