- Clone
- DX22 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- KP43
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CTTTCCGGTCCTACA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
305529 | 10 µg | $369 |
CD94 is a 43 kD type II transmembrane glycoprotein also known as KP43. CD94 belongs to the C-type lectin superfamily and is present as a covalently linked heterodimer with NKG2 on the cell surface. CD94 is expressed by NK cells, a subset of γδ T cells, and NKT cells. The CD94/NKG2A complex serves as an inhibitory receptor specific for HLA-class I molecules.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- NK cell line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunoprecipitation4, inhibition of NK cell-mediated lysis5, immunohistochemical staining of acetone-fixed frozen tissue sections, and spatial biology (IBEX)6,7.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Mizuki M, et al. 2000. Sarcoidosis Vasc. Diffuse Lung Dis. 17:54.
- Phillip J, et al. 1996. Immunity 5:163.
- Lazetic S, et al. 1996. J. Immunol. 157:4741.
- Lanier LL, et al. 1998. Immunity 8:693.
- Wooden SL, et al. 2005. J. Immunol. 175:1383.
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2941473 (BioLegend Cat. No. 305529)
Antigen Details
- Structure
- C-type lectin, type II transmembrane glycoprotein, covalently associates with NKG2, 43 kD
- Distribution
-
NK cells , T subset
- Function
- Inhibits NK function
- Cell Type
- NK cells, T cells
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules
- Antigen References
-
1. Lopez-Botet M, et al. 1997. Immunol. Rev. 155:165.
2. Moretta A, et al. 1997. Immunol. Rev. 155:105. - Gene ID
- 3824 View all products for this Gene ID
- UniProt
- View information about CD94 on UniProt.org
Other Formats
View All CD94 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
APC anti-human CD94 | DX22 | FC |
FITC anti-human CD94 | DX22 | FC |
PE anti-human CD94 | DX22 | FC,SB |
Purified anti-human CD94 | DX22 | FC,IHC-F |
Alexa Fluor® 647 anti-human CD94 | DX22 | FC |
PerCP/Cyanine5.5 anti-human CD94 | DX22 | FC |
PE/Cyanine7 anti-human CD94 | DX22 | FC |
APC/Fire™ 750 anti-human CD94 | DX22 | FC |
PE/Dazzle™ 594 anti-human CD94 | DX22 | FC |
TotalSeq™-A0867 anti-human CD94 | DX22 | PG |
TotalSeq™-C0867 anti-human CD94 | DX22 | PG |
PE/Fire™ 810 anti-human CD94 | DX22 | FC |
TotalSeq™-B0867 anti-human CD94 | DX22 | PG |
TotalSeq™-D0867 anti-human CD94 | DX22 | PG |
APC anti-human CD94 | DX22 | FC |
APC/Cyanine7 anti-human CD94 | DX22 | FC |
FITC anti-human CD94 | DX22 | FC |
GMP APC anti-human CD94 | DX22 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD94
Human peripheral blood lymphocytes stained with DX22 APC -
FITC anti-human CD94
Human peripheral blood lymphocytes stained with DX22 FITC -
PE anti-human CD94
Human peripheral blood lymphocytes stained with DX22 PE Confocal image of human lymph node sample acquired using the... -
Purified anti-human CD94
Human peripheral blood lymphocytes stained with purified DX2... -
Alexa Fluor® 647 anti-human CD94
Human peripheral blood lymphocytes stained with DX22 Alexa F... -
PerCP/Cyanine5.5 anti-human CD94
Human peripheral blood lymphocytes were stained with CD94 (c... -
PE/Cyanine7 anti-human CD94
Human peripheral blood lymphocytes were stained with CD94 (c... -
APC/Fire™ 750 anti-human CD94
Human peripheral blood lymphocytes were stained with CD94 (c... -
PE/Dazzle™ 594 anti-human CD94
Human peripheral blood lymphocytes were stained with CD94 (c... -
TotalSeq™-A0867 anti-human CD94
-
TotalSeq™-C0867 anti-human CD94
-
PE/Fire™ 810 anti-human CD94
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-B0867 anti-human CD94
-
TotalSeq™-D0867 anti-human CD94
-
APC anti-human CD94
Typical results from human peripheral blood lymphocytes stai... -
APC/Cyanine7 anti-human CD94
Human peripheral blood lymphocytes were stained with anti-hu... -
FITC anti-human CD94
Typical results from human peripheral blood lymphocytes stai... -
GMP APC anti-human CD94
Typical results from human peripheral blood lymphocytes stai...
Follow Us