- Clone
- 3D12 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- HLA class I histocompatibility antigen, alpha chain E, HLAE
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GAGTCGAGAAATCAT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
342623 | 10 µg | $369 |
HLA-E is a non-classical MHC class I (MHC-Ib) molecule. It is characterized by limited polymorphism and ubiquitous expression. HLA-E, as other MHC-I molecules, is heterodimerized with β2-microglobulin. HLA-E interacts with CD94/NKG2 receptor to regulate NK cell cytolysis activities.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Lee N, et al. 1998. Proc. Natl. Acad. Sci. USA. 95:5199.
- Wooden SL, et al. 2005. J. Immunol. 175:1383.
- Monaco EL, et al. 2008. J. Immunol. 181:5442.
- Corrah TW, et al. 2011. J. Virol. 85:3367. PubMed
- RRID
-
AB_2894584 (BioLegend Cat. No. 342623)
Antigen Details
- Structure
- HLA family, Ig superfamily, 42 kD
- Distribution
-
Broadly expressed
- Function
- Mediate cell recognition by NK cells
- Ligand/Receptor
- CD94/NKG2
- Biology Area
- Immunology
- Molecular Family
- MHC Antigens
- Antigen References
-
1. Sullivan LC, et al. 2008. Tissue Antigen. 72:415.
2. Koller BH, et al. 1988. J. Immunol. 141:897. - Gene ID
- 3133 View all products for this Gene ID
- UniProt
- View information about HLA-E on UniProt.org
Related FAQs
Other Formats
View All HLA-E Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human HLA-E | 3D12 | FC,IP |
PE anti-human HLA-E | 3D12 | FC |
APC anti-human HLA-E | 3D12 | FC |
PE/Cyanine7 anti-human HLA-E | 3D12 | FC |
PerCP/Cyanine5.5 anti-human HLA-E | 3D12 | FC |
Brilliant Violet 421™ anti-human HLA-E | 3D12 | FC |
PE/Dazzle™ 594 anti-human HLA-E | 3D12 | FC |
TotalSeq™-A0918 anti-human HLA-E | 3D12 | PG |
TotalSeq™-C0918 anti-human HLA-E | 3D12 | PG |
Biotin anti-human HLA-E | 3D12 | FC |
TotalSeq™-B0918 anti-human HLA-E | 3D12 | PG |
TotalSeq™-D0918 anti-human HLA-E | 3D12 | PG |
Brilliant Violet 605™ anti-human HLA-E | 3D12 | FC |
Brilliant Violet 650™ anti-human HLA-E | 3D12 | FC |
Brilliant Violet 711™ anti-human HLA-E | 3D12 | FC |
Brilliant Violet 785™ anti-human HLA-E | 3D12 | FC |
Spark Blue™ 574 anti-human HLA-E (Flexi-Fluor™) | 3D12 | FC |
Spark Blue™ 550 anti-human HLA-E (Flexi-Fluor™) | 3D12 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human HLA-E
Human peripheral blood lymphocytes stained with 3D12 PE -
PE anti-human HLA-E
Human peripheral blood lymphocytes stained with 3D12 PE -
APC anti-human HLA-E
Human peripheral blood lymphocytes were stained with HLA-E (... -
PE/Cyanine7 anti-human HLA-E
Human peripheral blood lymphocytes were stained with HLA-E (... -
PerCP/Cyanine5.5 anti-human HLA-E
Human peripheral blood lymphocytes were stained with HLA-E (... -
Brilliant Violet 421™ anti-human HLA-E
Human peripheral blood lymphocytes were stained with HLA-E (... -
PE/Dazzle™ 594 anti-human HLA-E
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-A0918 anti-human HLA-E
-
TotalSeq™-C0918 anti-human HLA-E
-
Biotin anti-human HLA-E
Human peripheral blood lymphocytes were stained with biotin... -
TotalSeq™-B0918 anti-human HLA-E
-
TotalSeq™-D0918 anti-human HLA-E
-
Brilliant Violet 605™ anti-human HLA-E
Human lysed whole blood was stained with anti-human HLA-E (c... Human lysed whole blood was stained with anti-human HLA-E (c... -
Brilliant Violet 650™ anti-human HLA-E
Human lysed whole blood was stained with anti-human HLA-E (c... -
Brilliant Violet 711™ anti-human HLA-E
Human peripheral blood lymphocytes were stained with anti-hu... Human peripheral blood lymphocytes, monocytes & granulocytes... -
Brilliant Violet 785™ anti-human HLA-E
Human peripheral blood lymphocytes were stained with anti-hu... Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Blue™ 574 anti-human HLA-E (Flexi-Fluor™)
-
Spark Blue™ 550 anti-human HLA-E (Flexi-Fluor™)
Follow Us