- Clone
- ASL-24 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- KAI1, C33, R2, 4F9, IA4
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TCCCACTTCCGCTTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
342119 | 10 µg | $369 |
CD82 is a 45-90 kD type III tetraspan membrane protein which is encoded by the KAI1 gene. A member of the 4-span transmembrane protein superfamily (TM4SF) CD82 forms a complex with CD37, CD53, CD81, ECM and MHC molecules. CD82 is expressed on monocytes, granulocytes, lymphocytes, epithelial cells, endothelial cells, and fibroblasts and plays a role in signal transduction and adhesion. It has been suggested CD82 functions as a tumor suppressor as loss of expression has been found to promote tumor metastasis.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2936650 (BioLegend Cat. No. 342119)
Antigen Details
- Structure
- Type III tetraspan membrane protein, 45-90 kD, complexed with CD37, CD53, CD81, ECM and MHC molecules, 4-span transmembrane protein superfamily (TM4SF)
- Distribution
-
Monocytes, granulocytes,lymphocytes, epithelial cells, endothelial cells, fibroblasts
- Function
- Signal transduction, adhesion, tumor metastasis suppressor
- Ligand/Receptor
- KITENIN
- Cell Type
- Basophils, Endothelial cells, Epithelial cells, Granulocytes, Lymphocytes, Monocytes
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Miranti CK. 2009. Cell. Signal. 21:196
2. Abe M, et al. 2008. 266:163
3. Lee JH et al. 2004. Cancer Res. 64:4235
4. Lagaudriere-Gesbert C, et al. 1997. J. Immunol. 158:2790 - Gene ID
- 3732 View all products for this Gene ID
- UniProt
- View information about CD82 on UniProt.org
Related FAQs
Other Formats
View All CD82 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD82 | ASL-24 | FC |
PE anti-human CD82 | ASL-24 | FC |
Alexa Fluor® 647 anti-human CD82 | ASL-24 | FC |
PE/Cyanine7 anti-human CD82 | ASL-24 | FC |
PerCP/Cyanine5.5 anti-human CD82 | ASL-24 | FC |
APC anti-human CD82 | ASL-24 | FC |
TotalSeq™-C0920 anti-human CD82 | ASL-24 | PG |
TotalSeq™-B0920 anti-human CD82 | ASL-24 | PG |
TotalSeq™-D0920 anti-human CD82 | ASL-24 | PG |
TotalSeq™-A0920 anti-human CD82 | ASL-24 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD82
Human peripheral blood lymphocytes stained with purified ASL... -
PE anti-human CD82
Human peripheral blood lymphocytes stained with ASL-24 PE. -
Alexa Fluor® 647 anti-human CD82
Human peripheral blood lymphocytes stained with ASL-24 Alexa... -
PE/Cyanine7 anti-human CD82
Human peripheral blood lymphocytes were stained with CD82 PE... -
PerCP/Cyanine5.5 anti-human CD82
Human peripheral blood lymphocytes were stained with CD82 Pe... -
APC anti-human CD82
Human peripheral blood lymphocytes were stained with CD82 AP... -
TotalSeq™-C0920 anti-human CD82
-
TotalSeq™-B0920 anti-human CD82
-
TotalSeq™-D0920 anti-human CD82
-
TotalSeq™-A0920 anti-human CD82
Follow Us